Molecular cloning and expression analysis of scd1 gene from large yellow croaker Larimichthys crocea under cold stress

Gene 568 (2015) 100–108

Contents lists available at ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

Research paper

Molecular cloning and expression analysis of scd1 gene from large yellow croaker Larimichthys crocea under cold stress Hao Xu a,1, Dong Ling Zhang a,1, Da Hui Yu b, Chang Huan Lv a, Hui Yu Luo a, Zhi Yong Wang a,⁎ a

Key Laboratory of Healthy Mariculture for the East China Sea, Ministry of Agriculture, Fisheries College, Jimei University, Xiamen 361021, PR China Key Laboratory of South China Sea Fishery Resources Exploitation & Utilization, Ministry of Agriculture, South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Guangzhou 510300, PR China

b

a r t i c l e

i n f o

Article history: Received 12 February 2015 Received in revised form 24 April 2015 Accepted 11 May 2015 Available online 13 May 2015 Keywords: Cold challenge Stearoyl-CoA desaturase (SCD) Larimichthys crocea

a b s t r a c t Desaturation of fatty acids is an important adaptation mechanism to maintain membrane fluidity under cold stress. To comprehend the mechanism of adaptation to low temperatures in fish, we investigated stearoyl-CoA desaturase 1 (SCD1) endocrine expression in the process of cold acclimation from 15 °C to 7 °C in Larimichthys crocea. The cDNA and genomic sequences of scd1 were cloned and characterized and named as Lcscd1. The cDNA encoded an iron-containing protein of 337 amino acids with functional motifs. The full-length genome sequence of Lcscd1 was composed of 2556 nucleotides, including five exons and four introns. Tissue expression profiles by qPCR and western blot analysis revealed that Lcscd1 was highly expressed in the liver, followed by the brain. The expression of Lcscd1 mRNA in the liver was firstly down-regulated from 15 °C to 11 °C, and then up-regulated until the first day of 7 °C, followed by a decline until the last day. In the brain, the expression showed no significant change from 15 °C to 9 °C, but then significantly increased until the last day of 7 °C. SCD1 protein expression in the liver decreased from 15 °C to the first day of 7 °C, and then gradually recovered to the starting level. In the brain, SCD1 protein expression maintained rising trends in the whole process. Immunoelectron microscopic analysis showed that SCD1 was localized in fat granules, mitochondria and granular endoplasmic reticulum of hepatic cells, but only in mitochondria of encephalic cells. The results above suggested that SCD1 expression was responsive to both cold and starvation stresses in the liver, but only to cold stress in the brain. In conclusion, these findings suggested that SCD1 may be involved in fish adaptation to cold stress. © 2015 Elsevier B.V. All rights reserved.

1. Introduction Fishes, as ectothermic animals, the physiological and metabolic activities are mainly influenced by water temperature. Severe cold weather often resulted in mass mortality of commercially important cultured species such as tilapia (Oreochromis niloticus) (Zerai et al., 2010), orange-spotted grouper (Epinephelus coioides) (Qi et al., 2013) and gilthead sea bream (Sparus aurata) (Mininni et al., 2014). It was reported that maintenance of cell membrane fluidity was an effective way to adapt to cold stress for fishes (Hsieh and Kuo, 2005; Hazel, 1979; Bell et al., 1986). Unsaturated fatty acid is a key composition of cellular membrane to maintain the membrane fluidity (Spector and Yorek, 1985; Popp-Snijders et al., 1986; Calder, 2012). Therefore, the increase

Abbreviations: SCD1, stearoyl-CoA desaturase 1; LcSCD1, Larimichthys crocea SCD1; qPCR, quantitative real-time PCR; UTR, untranslated region; ER, endoplasmic reticulum; GER, granular endoplasmic reticulum. ⁎ Corresponding author at: Key Laboratory of Healthy Mariculture for the East China Sea, Ministry of Agriculture, Fisheries College, Jimei University, Xiamen, Fujian Province 361021, PR China. E-mail address: [email protected] (Z.Y. Wang). 1 These authors contributed equally to this work.

http://dx.doi.org/10.1016/j.gene.2015.05.027 0378-1119/© 2015 Elsevier B.V. All rights reserved.

of the unsaturated fatty acid proportion can improve the fluidity of membrane, and enhance the adaptive ability of fish against cold stress. Stearoyl-CoA desaturase (SCD, EC 1.14.99.5) is a rate-limiting enzyme in the synthesis of monounsaturated fatty acid, and involved in forming a cis-double bonds between carbon 9 and carbon 10 in both palmitoyl-CoA (16:0) and stearoyl-CoA (18:0), which are converted to be palmitoleoy-CoA (16:1) and oleoyl-CoA (18:1), respectively (Tocher et al., 1998). Palmitoleic and oleic acids are major elements in membrane cholesterol esters, phospholipids and triglycerides (Miyazaki et al., 2000). Since stearoyl-CoA desaturase is responsible for desaturation of fatty acids, it should be activated under cold stress to increase the proportion of monounsaturated fatty acids for improving the membrane fluidity and thus enhancing the ability of cold adaption (Tiku et al., 1996; Trueman et al., 2000). Several reports demonstrated that the expression of stearoyl-CoA desaturase significantly increased in several teleost fishes under cold stress (Tiku et al., 1996; Polley et al., 2003; Hsieh and Kuo, 2005; Zerai et al., 2010). Yet whether it is responsive to cold stress in large yellow croaker (Larimichthys crocea) or not is not reported to date. Large yellow croaker, L. crocea, is one of the most economically important marine cultured species in China (Zhang et al., 2015), but it is vulnerable to cold weather and high mortality occurs when water temperature drops below 7 °C (Gao et al., 2010), leading to significant

H. Xu et al. / Gene 568 (2015) 100–108 Table 1 Primers used for scd1 cloning and expression analysis. Primer name

Nucleotide sequence (5′ → 3′)

Purpose

scd1F scd1R scd13F1 scd13F2 scd15R1 scd15R2 scd1GF scd1GR scd1QF scd1QR β-Actin-F β-Actin-R AAP AOLP AP

CCATGGCCTTCCARAAYGAYAT CTTGCCCCACATRTGNGC GCTGGAACTCACTGACCTACGC ATGTTGCTGAACGCTACCTGG CTTGCGTCCTTTCTCAATAACATCGG ATTTGTGATGAACCCTGTGGTCT AACTCTTGTTTTCTACTCGTCCGC TGGTCAAGGCCCTCATGAAACT AAAGGACGCAAGCTGGAACT CTGGGACGAAGTACGACACC TTATGAAGGCTATGCCCTGCC TGAAGGAGTAGCCACGCTCTGT GGCCACGCGTCGACTAGTAC(G)10 GGCCACGCGTCGACTAGTAC(T)16 GGCCACGCGTCGACTAGTAC

Homologous amplification 3′ race method

101

In the present study, we identified SCD1 isoform from L. crocea (LcSCD1) and detected its tissue distribution. In order to better understand its potential role in response to cold, we investigated the change trend of LcSCD1 expression with the decrease of temperature at both RNA and protein levels. In addition, we also positioned its subcellular localization.

5′ race method Genomic sequence

2. Materials and methods

mRNA expression

2.1. Fish and cold acclimation

Oligo dC AP Adaptor primers

N = A, C, G or T; V = A, G or C; M = A or C; Y = C or T; R = A or G.

economic losses against the culture industry. Therefore, it is urgent to investigate the molecular signals of L. crocea to cold stress and to breed a new strain of the fish that can be against low temperature stress.

All animals used in this study were handled according to the Guidelines of China Association for Animal Care and Use. L. crocea (45 ± 5 g) were obtained from Zhujiajian Base of Zhoushan Fisheries Research Institute, Zhejiang Province, China. The fish were kept in a seawater pond (3 m × 4 m) at temperature 15 ± 0.5 °C, feed with commercial feed. After 10 day acclimation, water temperature in the pond decreased 2 °C per day from 15 °C to 7 °C and sustained 5 days at 7 °C. Brain and liver samples were collected at 15 °C, 13 °C, 11 °C, 9 °C, 7 °C (day 1), 7 °C (day 3) and 7 °C (day 5), respectively. Five fish were sampled at

Fig. 1. Multiple alignment of SCD1 amino acid sequences. The comparison includes SCD1 sequences from the teleost species L. crocea (Lc, GenBank accession: KP202156), Salmo salar (Ss, ACN11041), Oreochromis niloticus (On, CDQ79854), Danio rerio (Dr, AAO25582), Gallus gallus (Gg, NP_990221), H. sapiens (Hs, NP_005054.3). Identical amino acids are highlighted in black, strongly similar amino acids are printed in white letters with dark gray underline. Conserved eight histidine (His) residues are indicated with double asterisk. Solid line marks four transmembrane domains.

102

H. Xu et al. / Gene 568 (2015) 100–108

Fig. 2. Phylogenetic trees analysis based on SCD1 amino sequences. GenBank Accession numbers of sequences used are L. crocea (KP202156), O. niloticus (XP_003441845), S. aurata (AFP97551), D. labrax (CBN81527), O. mossambicus (AAN77732), O. latipes (XP_004080473), T. rubripes (NP_001072045), C. idella (CAB53008), L. oculatus (XP_006630411), S. salar (ACN11041), O. mykiss (CDQ79854), S. partitus (XP_008277044), C. hamatus (CAB56151), C. chanos (AAL99291), D. rerio (AAO25582), G. gallus (NP_990221), X. tropicalis (NP_001027500), X. laevis (NP_001087809), M. musculus (NP_033153), H. sapiens (NP_005054). The scale bar is 0.05.

Fig. 3. Structural features of Lcscd1 gene. Comparative illustrations on scd1 gene structures from various vertebrates were shown. Exons are represented by boxes, introns are represented by line. Intron lengths in base pairs are shown at the bottom of each figure and exon lengths are on the top.

H. Xu et al. / Gene 568 (2015) 100–108

each temperature point. The whole experiment was operated in winter, and it was about 7 °C. 2.2. RNA, DNA isolation and cDNA synthesis Total RNA was extracted with Trizol reagents (Invitrogen, USA) following the instructions of the manufacturer. The genomic DNA was isolated with Tianamp Marine Animals DNA Kit (Tiangen, China) based on the instructions of the manufacturer. The first cDNA was synthesized from 1 μg of RNA without DNA contamination using PrimeScript RT reagent kit (TaKaRa, Japan) according to the manufacturer's protocol. 2.3. cDNA cloning of scd1 Two degenerate primers were designed according to the conserved domains of other teleost fishes. The central region of cDNA of scd1 was amplified using scd1F and scd1R (Table 1) with liver cDNA template, annealing at 53 °C. The PCR product was cloned into pMD19-T vector (TaKaRa, Japan) and sequenced (Invitrogen, USA). Based on the partial cDNA sequences of scd1, 5′ and 3′ sequences were obtained by RACE-PCR using adaptor primers and gene-specific primers (Table 1). The 3′ RACE-PCR was performed with gene-specific primer scd13F1 and the adapter primer AOLP for the first round PCR, annealing at 53 °C. Subsequently, nested PCR was carried out with primer scd13F2 and AP, annealing at 58 °C.

103

For the 5′ amplification, the cDNA was purified with a DNA purification kit (OMEGA, USA) and tailed with poly C at the 3′ by terminal deoxynucleotidyl transferase (TdT) (Fermentas, USA). PCR was performed initially with scd15R1 primer and adapter primer AAP using the tailed cDNA as the template, annealing at 55 °C. Then nested PCR was carried out with a specific primer scd15R1 and adapter primer AP, annealing at 58 °C. PCR products were gel-purified, cloned, and sequenced as described above. 2.4. Molecular cloning of Lcscd1 genomic DNA Two primers were designed based on multiple alignments of known scd1 genomic sequences. PCR was performed with scd1GF and scd1GR (Table 1) primers and genomic DNA as a template, annealing at 55 °C. PCR products were cloned into pMD19-T vector and sequenced as described above. 2.5. Sequence analysis Sequence similarity analysis was performed using BLAST program at the National Center of Biotechnology Information (NCBI) (http://blast. ncbi.nlm.nih.gov blast.cgi). Protein structure was predicted by SMART (http://smart.embl-heidelberg.de/). Multiple sequence alignment was performed using the CLUSTALX program (http://www.ebi.ac. uk/clustaw/). Phylogenetic tree was reconstructed by MEGA software version 5.0 using the neighbor-joining method. Genomic

Fig. 4. Expression profiles of Lcscd1 mRNA (A) and protein (B) expression levels in various tissues of L. crocea by quantitative real-time PCR. The data was normalized against β-actin. Each experiment was performed in triplicate. Data (mean ± SE, n = 5) are indicated with significantly different letters (a, b, c).

104

H. Xu et al. / Gene 568 (2015) 100–108

2.7. Western blot analysis To further understand the tissue expression profiles and expression variation of SCD1 at protein level under cold stimulus, western-blot was performed. Samples were lysed in RIPA Lysis buffer (50 mM Tris–HCl, 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 1.0 mM EDTA, 0.1% SDS and 0.01% sodium azide) (Erker et al., 2013). After centrifugation at 12,000 g, the supernatants were analyzed in 10% SDS-PAGE gels and transferred onto a nitrocellulose membrane (Bio-Rad, USA). Then the

Fig. 5. Transcription expression changes of scd1 in L. crocea liver (A) and brain (B) with temperature fallings revealed by real-time PCR. The mRNA expression level was normalized against β-actin. Data were shown as the mean ± SE (N = 5). Each experiment was performed in triplicate. Significant differences of expression among the treatments were indicated with different letters (a, b, c, d, e).

analysis was performed using MGAlign software (http://proline.bic. nus.edu.sg/mgalign/mgalignit.html). 2.6. Quantitative real-time PCR analysis For tissue expression profile analysis, various tissues including the brain, heart, gill, liver, spleen, kidney, head kidney, intestine and muscle were collected from five individuals, respectively. Total RNA was extracted, treated with DNase I and reverse transcribed into the first strand cDNA. Quantitative Real-time PCR (qRCR) was performed with the primers scdQF/R (Table 1). β-actin (ADN52693) was amplified as an internal control to determine the concentration of each template with the primer β-actin-F/R (Table 1). Real-time PCR was performed on Roche LightCycler 480 using SYBR Premix ExTaqTM (TaKaRa). Cycling conditions were 2 min at 95 °C, then 40 cycles of 95 °C for 15 s, and 60 °C for 20 s. Relative gene expression was analyzed by 2−ΔΔCt method (Livak and Schmittgen, 2001). SPSS software (version 16.0) was used for the significance test. Data was expressed as Mean ± SE. P b 0.05 was considered statistically significantly different. For expression changing analysis of scd1 under cold stress, brain and liver samples were collected from different temperatures. Real-time PCR was performed and analyzed as described above.

Fig. 6. Analysis of LcSCD1 translation changes in the liver (A) and brain (B) under cold stress by western blot. The protein expression level was normalized against β-actin. Data were shown as the mean ± SE (N = 5). Each experiment was performed in triplicate. Significant differences of expression among the treatments were indicated with different letters (a, b).

H. Xu et al. / Gene 568 (2015) 100–108

membrane was immersed in blocking buffer at room temperature for 2 h, and then incubated with the first antibody rabbit anti-SCD1 antibody (1/500, Abcam, England. The amino sequence of peptide antigen is 70%

105

homology with SCD1 in L. crocea) overnight at 4 °C. Following rinsing with TBST, the membrane was incubated with secondary antibody HRPconjugated anti-rabbit (1/4000, Pierce, USA) for 2 h at room temperature.

Fig. 7. SCD1 location was shown via immunoelectronic microscopy. The black dots indicated signals from gold particles localized in the liver and brain. In hepatic cells, gold particles (arrow-headed) were detected in fat granule (A, B), mitochondria (C, D) and granular endoplasmic reticulum (E, F). In encephalic cells, gold particles were detected in mitochondria (G, H). Bar represents 200 nm.

106

H. Xu et al. / Gene 568 (2015) 100–108

The mouse anti-β-actin antibody (1/700, Saint Cruz, USA) and HRPconjugated anti-mouse (1/4000, Pierce, USA) were as an internal control. The immunoreactive band was detected using BeyoECL Plus (Beyotime, China) by GE ImageQuant LAS4000mini (GE, USA).

with Lcscd1 mRNA expression pattern in most tissues, except for muscle.

2.8. Subcellular localization of LcSCD1 by immunoelectron microscopy Immunoelectron microscopy was performed to detect the subcellular location of SCD1 in brain and liver tissues. Samples were fixed in a mixture of 2% paraformaldehyde, 0.5% glutaraldehyde in 0.1 M PBS buffer (pH 7.4) (Ueo et al., 2013). Subsequently, the samples were dehydrated in ascending graded ethanol, and immerged in LR-White resin, which was polymerized at 55 °C for 24 h. Resin blocks were ultrathin-sectioned using an ultramicrotome at a thickness of 60 nm. Then these thin sections were mounted on nickel grids. To remove the aldehydes, the grids were floated on drops of 0.05 M glycine for 15 min. After embedded into the blocking buffer for 30 min at room temperature, the sections were incubated with the anti-SCD1 antibody overnight at 4 °C, and then rinsed with incubation buffer. Immediately, the sections were incubated with 15 nm gold-conjugated goat anti-rabbit IgG antibody (Sagon, China) for 30 min at room temperature. Incubation buffer without anti-SCD1 antibody was used as negative control. The ultrathin sections were stained with uranyl acetate, and examined under a transmission electron microscope (JEM, Japan).

To further understand the time-course of Lcscd1 gene transcription and translation under cold stress, a relative qPCR and western blot analyses were employed to detect the transcriptional and translational levels of Lcscd1 gene in metabolic organ (liver) and life organ (brain) at 15 °C, 11 °C, 9 °C, 7 °C (day 1), 7 °C (day 3) and 7 °C (day 5). As shown (Fig. 5), mRNA expression level of Lcscd1 in the liver was sharp down-regulated from 15 °C to 11 °C (40.3%), then up-regulated from 9 °C to the first day of 7 °C (1.2-fold of 15 °C group), and finally declined until the last day of 7 °C (Fig. 5A). In the brain, Lcscd1 transcripts have no significant differences from 15 °C to 9 °C. However, it rapidly increased from the first day of 7 °C (2.03 folds of 15 °C) to the last day (13.43-fold of 15 °C) (Fig. 5B). The protein expression level of LcSCD1 in liver was down-regulated from 15 °C to the first day of 7 °C, and then recovered to the primary level at the third and the last day of 7 °C (Fig. 6A). In the brain, LcSCD1 protein expression has no significant differences from 15 °C to 11 °C compared with the initial 15 °C point, but it sharply increased from 9 °C to the fifth day of 7 °C. The peak value was at the first day of 7 °C with 7.04-fold as much as that of 15 °C (Fig. 6B).

3. Results

3.5. Subcellular localization of SCD1

3.1. Cloning and sequence analysis of Lcscd1

To confirm the localization of SCD1 in liver and brain cells, a dual label indirect immunoelectron microscopy assay was performed. Incubation buffer without rabbit anti-SCD1 antibody was taken as a negative control. Gold particle signals were clearly detected in fat granules, mitochondria and granular endoplasmic reticulum of hepatic cells. Compared with these results, gold particles were detected only in mitochondria of encephalic cells (Fig. 7).

The amplified cDNA fragment was 392 bp using primers scd1F and scd1R. Subsequently, a fragment of 447 bp was obtained by 3′ RACE PCR, and a 537 fragment was obtained by 5′ RACE PCR. As a result, a 1250 bp full-length cDNA (KP202156, named as Lcscd1) was obtained by alignment of the above fragments, with an open reading frame (ORF) of 1014 bp, encoding 337 amino acid residues (Fig. 1). The 5′ untranslated region (UTR) was 104 bp and a 3′ UTR was 132 bp with a stop codon (TAA). The deduced amino acid sequence of the ORF was identical to the SCD1 of other fishes by 70–80% (Fig. 1). The predicted molecular mass of deduced LcSCD1 was 38.7 kDa and the isoelectric point was 8.87. Prediction of protein domains by SMART program revealed that LcSCD1 consisted of four transmembrane domains at positions 48–70, 80–102, 194–216 and 220–242, three histidine-rich regions, one HXXXXH (98–103), and two HXXHH (135–139 and 276–280) motifs. Phylogenetic tree analysis indicated that L. crocea was in the same subgroup with other fishes and had the closest phylogenetic relationship with Oryzias latipes (Fig. 2). 3.2. The genomic DNA sequence of Lcscd1 gene The fragment of 2556 bp was amplified using primers scd1GF and scd1GR and was deposited to GenBank with the accession number KP202157. The sequence contained five exons and four introns as indicated by MGAlign analysis (Fig. 3). A multiple sequence alignment indicated that Lcscd1 sequence shared 82% identity with the genomic DNA sequence of scd1 gene in Dicentrarchus labrax. 3.3. Tissue expression profiles of Lcscd1 To determine Lcscd1 mRNA expression levels in various tissues from L. crocea, qPCR was performed. The results showed that Lcscd1 was expressed the highest in liver (P b 0.01), followed by the brain and muscle (P b 0.05) (Fig. 4A). In western blot analysis, the results showed that a single band with molecular mass of approximately 45 kDa was higher than the molecular mass of 38.7 kDa predicated by its amino acid sequence (Fig. 4B). The tissue profile of LcSCD1 protein was consistent

3.4. Expression changes of Lcscd1 gene under cold stress

4. Discussion Every year, numerous L. crocea were frozen to death, and the culture industry suffered tremendous economic losses (Gao et al., 2010). So it is urgent to investigate its molecular signals to cold stress. SCD1 was reported to be involved in enhancing the adaptive ability of fish against cold stress (Tiku et al., 1996; Trueman et al., 2000). In this paper, we isolated and characterized the cDNA and genomic DNA of scd1 gene from L. crocea, and predicted its protein sequence and functional domains. LcSCD1 protein possesses four transmembrane domains that are conserved in teleost SCD1 (Man et al., 2006; Lengi and Corl, 2007), and likely to be associated with transporting electron from cytochrome to oxygen and with the conversion of saturated fatty acids into monounsaturated fatty acids (Zheng et al., 2001; Shinomura et al., 1991). Eight histidine (His) residues form the His box, which binds iron within the catalytic center of the desaturase (Paton and Ntambi, 2009) (Fig. 1). In addition, LcSCD1 was in the same phylogenetic cluster with other fishes, indicating that they shared a common evolutionary origin and similar function (Fig. 2). In mammal, five isoforms of SCD have been identified. The distribution of these isoforms varies greatly among tissues. SCD1 is mainly expressed in the liver, whereas SCD2 and SCD5 are mainly expressed in the brain, and SCD3 and SCD4 are tissue-specific proteins expressed in the skin and heart, respectively (Hodson and Fielding, 2013; Lengi and Corl, 2007; Miyazaki et al., 2003; Ntambi and Miyazaki, 2003;). In fish, only two SCD isoforms, SCD1 and SCD2 were found in grass carp (Ctenopharyngodon idella), and were highly expressed in the liver but low in the brain (Chang et al., 2001; Polley et al., 2003; Evans et al., 2008). In tilapia, SCD1 was only expressed in the liver (Hsieh et al., 2004), while in milkfish and zebrafish, SCD1 was found in various tissues (Hsieh et al., 2001, 2003). In the present study, Lcscd1 is mainly

H. Xu et al. / Gene 568 (2015) 100–108

expressed in the liver, and then in the brain by real-time PCR and western blot (Fig. 4). These differences in the expression profiles of desaturase between fishes and mammals implied disparate regulation mechanisms and possibly reflected differences in the physiological requirements for the enzyme between these animals. Based on western blot analysis, the anti-SCD1 antibody against LcSCD1 showed a single band of approximately 45 kDa, which was higher than the predicted molecular mass of 38.7 kDa with its deduced amino acid sequence (Fig. 4B). These may be due to the ten N-linked glycosylation sites predicted in SCD1 at N19, N28, N53, N120, N150, N237, N243, N251, N263, and N277. Several reports showed that specific antibodies against some antigens may also recognize a protein higher than the predicted molecular mass due to glycosylation and special structure (Takakura et al., 2008). These findings suggested that glycosylation and iron-containing structure contributed to the higher molecular mass, and the anti-SCD1 antibody in this study was applicable to specific immune detection. It was reported that SCD1 played an important role in the metabolism of fatty acids and regulation of membrane fluidity under temperature fluctuations (Zhang et al., 2014; Trueman et al., 2000). The transcription of scd1 in liver increased after day 2 of 15 °C cold acclimation for milkfish, in contrast, in grass carp scd1 mRNA expression in liver was up-regulated after day 21 of 15 °C cold acclimation (Hsieh and Kuo, 2005). In Nile Tilapia scd1 mRNA expression was greater than 16-fold increase following 7 days of cold exposure (Zerai et al., 2010). Similarly, SCD1 activity increased 8- and 10-fold in carp when the temperature was decreased from 30 °C to 10 °C gradually (Tiku et al., 1996). In present study, interestingly, there were two different expression patterns for SCD1 respectively in the liver (Figs. 5A, 6A) and the brain (Figs. 5B, 6B). Based on the qPCR analysis, scd1 mRNA expression in the liver was firstly down-regulated from 15 °C to 11 °C, and then recovered until the first day of 7 °C, followed by a decline until the last day (Fig. 5A). In the brain, the expression showed no significant change from 15 °C to 9 °C, and then significantly increased when the temperature continued to decrease (Fig. 5B). It has been reported that food deprivation was confirmed to decrease SCD1 activity in the liver in zebrafish, but the SCD1 activity in brain didn't change significantly (Drew et al., 2008). Considering the fact that cold stress could reduce food intake of fish (Vega-Rubín de Celis et al., 2003), the present results suggested that Lcscd1 gene expression in the liver is influenced by both cold and starvation stresses, but the expression in the brain seems to be influenced mainly by cold stress. Western blot was performed to further explore LcSCD1 protein in response to cold acclimation. SCD1 expression in the liver decreased from 15 °C to the first day of 7 °C, and then gradually recovered to the primary level (Fig. 6A). In the brain, SCD1 protein expression maintained going up trends in the whole process (Fig. 6B). The results again confirmed that SCD1 expression in the liver was responsive to cold and starvation stresses, while in the brain, it was responsive more for cold acclimation. In addition, scd1 mRNA level is inconsistent with protein expression, similar to those of previous report for other genes (Jung et al., 2012; de Sousa Abreu et al., 2009; Maier et al., 2009). Taken together, the studies revealed that SCD1 might play an important role in the process of cold acclimation. The immunolocalization of SCD1 in liver and brain cells is a novel observation in fish. Previous studies in mammalian have localized SCD1 in endoplasmic reticulum (ER) in 293 cells by immunofluorescent microscope (Hodson and Fielding, 2013; Wang et al., 2005). In present study, SCD1 was located in fat granules, mitochondria and granular endoplasmic reticulum (GER) in liver cells, but only in mitochondria in brain cells by immunoelectron microscopy (Fig. 7). Mitochondria, as energy factories, are oxidative metabolism sites, while granular endoplasmic reticula are protein synthesis sites. Therefore, the liver maybe involved in metabolism and synthesis of SCD1, while the brain is only involved in metabolism of SCD1, which perhaps is the reason that SCD1 expression was responsive for both cold and starvation stresses in the liver, but only to cold stress in the brain.

107

In conclusion, we have identified and characterized a scd1 gene from L. crocea and provided evidence that SCD1 could be involved in cold stress. Additionally, we reported the subcellular localization of SCD1 in GERs, fat granules, and mitochondria. This information suggested that LcSCD1 play an important role in fish adaptation to cold stress. Yet, detailed pathways in it need to be studied further. Acknowledgments This work was supported by grants from the National ‘863’ Project of China (2012AA10A403) to ZYW, the National Natural Science Foundation of China (U1205122) to ZYW, the Foundation for Innovation Research Team of Jimei University (2010A02) to ZYW, the Key Fund Projects in Fujian Provincial Department of Education (JA13171) to DLZ, the Science Foundation of Jimei University (ZQ2013016, ZC2013003) to DLZ, the Key Level 1 Discipline Open Fund of Zhejiang Province (xkzsc08) to DLZ, and Fund of Key Laboratory of Sustainable Development of Marine Fisheries, Ministry of Agriculture, P. R. China (2013-SDMFMA-KF-8) to DLZ. Appendix A. Supplementary data Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.gene.2015.05.027. References Bell, M., Henderson, R., Sargent, J., 1986. The role of polyunsaturated fatty acids in fish. Comp. Biochem. Physiol. B 83, 711–719. Calder, P.C., 2012. Mechanisms of action of (n−3) fatty acids. J. Nutr. 142, 592S–599S. Chang, B.E., Hsieh, S.L., Kuo, C.M., 2001. Molecular cloning of full-length cDNA encoding delta-9 desaturase through PCR strategies and its genomic organization and expression in grass carp (Ctenopharyngodon idella). Mol. Reprod. Dev. 58, 245–254. de Sousa Abreu, R., Penalva, L.O., Marcotte, E.M., Vogel, C., 2009. Global signatures of protein and mRNA expression levels. Mol. BioSyst. 5, 1512–1526. Drew, R.E., Rodnick, K.J., Settles, M., Wacyk, J., Churchill, E., Powell, M.S., Hardy, R.W., Murdoch, G.K., Hill, R.A., Robison, B.D., 2008. Effect of starvation on transcriptomes of brain and liver in adult female zebrafish (Danio rerio). Physiol. Genomics 35, 283–295. Erker, Y., Neyret-Kahn, H., Seeler, J.S., Dejean, A., Atfi, A., Levy, L., 2013. Arkadia, a novel SUMO-targeted ubiquitin ligase involved in PML degradation. Mol. Cell. Biol. 33, 2163–2177. Evans, H., De Tomaso, T., Quail, M., Rogers, J., Gracey, A.Y., Cossins, A.R., Berenbrink, M., 2008. Ancient and modern duplication events and the evolution of stearoyl-CoA desaturases in teleost fishes. Physiol. Genomics 35, 18–29. Gao, G.Q., Chang, Y.M., Han, Q.X., Chi, B.J., Li, M.Y., Xue, L.Y., Liang, L.Q., 2010. Screening of microsatellite markers associated with cold tolerance of large yellow croaker (Pseudosciaena crocea). Hereditas 32, 248–253 (Chinese). Hazel, J.R., 1979. Influence of thermal acclimation on membrane lipid composition of rainbow trout liver. Am. J. Physiol. 236, R91–R101. Hodson, L., Fielding, B.A., 2013. Stearoyl-CoA desaturase: rogue or innocent bystander? Prog. Lipid Res. 52, 15–42. Hsieh, S.L., Kuo, C.M., 2005. Stearoyl-CoA desaturase expression and fatty acid composition in milkfish (Chanos chanos) and grass carp (Ctenopharyngodon idella) during cold acclimation. Comp. Biochem. Physiol. B 141, 95–101. Hsieh, S.L., Liao, W.L., Kuo, C.M., 2001. Molecular cloning and sequence analysis of stearoyl-CoA desaturase in milkfish, Chanos chanos. Comp. Biochem. Physiol. B 130, 467–477. Hsieh, S.L., Liu, R., Wu, C., Cheng, W., Kuo, C.M., 2003. cDNA nucleotide sequence coding for stearoyl-CoA desaturase and its expression in the zebrafish (Danio rerio) embryo. Mol. Reprod. Dev. 66, 325–333. Hsieh, S.L., Chang, H.T., Wu, C.H., Kuo, C.M., 2004. Cloning, tissue distribution and hormonal regulation of stearoyl-CoA desaturase in tilapia, Oreochromis mossambicus. Aquaculture 230, 527–546. Jung, D., Sato, J.D., Shaw, J.R., Stanton, B.A., 2012. Expression of aquaporin 3 in gills of the Atlantic killifish (Fundulus heteroclitus): effects of seawater acclimation. Comp. Biochem. Physiol. A 161, 320–326. Lengi, A.J., Corl, B.A., 2007. Identification and characterization of a novel bovine stearoylCoA desaturase isoform with homology to human SCD5. Lipids 42, 499–508. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(−delta delta C(T)) method. Methods 25, 402–408. Maier, T., Güell, M., Serrano, L., 2009. Correlation of mRNA and protein in complex biological samples. FEBS Lett. 583, 3966–3973. Man, W.C., Miyazaki, M., Chu, K., Ntambi, J.M., 2006. Membrane topology of mouse stearoyl-CoA desaturase 1. J. Biol. Chem. 281, 1251–1260. Mininni, A.N., Milan, M., Ferraresso, S., Petochi, T., Di Marco, P., Marino, G., Livi, S., Romualdi, C., Bargelloni, L., Patarnello, T., 2014. Liver transcriptome analysis in gilthead sea bream upon exposure to low temperature. BMC Genomics 15, 765–777.

108

H. Xu et al. / Gene 568 (2015) 100–108

Miyazaki, M., Kim, Y.C., Gray-Keller, M.P., Attie, A.D., Ntambi, J.M., 2000. The biosynthesis of hepatic cholesterol esters and triglycerides is impaired in mice with a disruption of the gene for stearoyl-CoA desaturase 1. J. Biol. Chem. 275, 30132–30138. Miyazaki, M., Jacobson, M.J., Man, W.C., Cohen, P., Asilmaz, E., Friedman, J.M., Ntambi, J.M., 2003. Identification and characterization of murine SCD4, a novel heart-specific stearoyl-CoA desaturase isoform regulated by leptin and dietary factors. J. Biol. Chem. 278, 33904–33911. Ntambi, J.M., Miyazaki, M., 2003. Recent insights into stearoyl-CoA desaturase-1. Curr. Opin. Lipidol. 14, 255–261. Paton, C.M., Ntambi, J.M., 2009. Biochemical and physiological function of stearoyl-CoA desaturase. Am. J. Physiol. Endocrinol. Metab. 297, 28–37. Polley, S.D., Tiku, P.E., Trueman, R.T., Caddick, M.X., Morozov, I.Y., Cossins, A.R., 2003. Differential expression of cold-and diet-specific genes encoding two carp liver Δ9-acylCoA desaturase isoforms. Am. J. Physiol. Regul. Integr. Comp. Physiol. 284, R41–R50. Popp-Snijders, C., Schouten, J., Van Blitterswijk, W., Van Der Veen, E., 1986. Changes in membrane lipid composition of human erythrocytes after dietary supplementation of (n−3) polyunsaturated fatty acids. Maintenance of membrane fluidity. Biochim. Biophys. Acta 854, 31–37. Qi, Z.H., Liu, Y.F., Luo, S.W., Chen, C.X., Liu, Y., Wang, W.N., 2013. Molecular cloning, characterization and expression analysis of tumor suppressor protein p53 from orangespotted grouper, Epinephelus coioides in response to temperature stress. Fish Shellfish Immunol. 35, 1466–1476. Shinomura, T., Asaoka, Y., Oka, M., Yoshida, K., Nishizuka, Y., 1991. Synergistic action of diacylglycerol and unsaturated fatty acid for protein kinase C activation: its possible implications. Proc. Natl. Acad. Sci. 88, 5149–5153. Spector, A.A., Yorek, M.A., 1985. Membrane lipid composition and cellular function. J. Lipid Res. 26, 1015–1035. Takakura, D., Norizuki, M., Ishikawa, F., Samata, T., 2008. Isolation and characterization of the N-linked oligosaccharides in nacrein from Pinctada fucata. Mar. Biotechnol. 10, 290–296. Tiku, P., Gracey, A., Macartney, A., Beynon, R., Cossins, A., 1996. Cold-induced expression of Δ9-desaturase in carp by transcriptional and posttranslational mechanisms. Science 271, 815–818.

Tocher, D., Leaver, M., Hodgson, P., 1998. Recent advances in the biochemistry and molecular biology of fatty acyl desaturases. Prog. Lipid Res. 37, 73–117. Trueman, R., Tiku, P., Caddick, M., Cossins, A., 2000. Thermal thresholds of lipid restructuring and delta (9)-desaturase expression in the liver of carp (Cyprinus carpio L.). J. Exp. Biol. 203, 641–650. Ueo, T., Yonemasu, H., Yada, N., Yano, S., Ishida, T., Urabe, M., Takahashi, K., Nagamatsu, H., Narita, R., Yao, K., Daa, T., Yokoyama, S., 2013. White opaque substance represents an intracytoplasmic accumulation of lipid droplets: immunohistochemical and immunoelectron microscopic investigation of 26 cases. Dig. Endosc. 25, 147–155. Vega-Rubín de Celis, S., Gómez, P., Calduch-Giner, J.A., Médale, F., Pérez-Sánchez, J., 2003. Expression and characterization of European sea bass (Dicentrarchus labrax) somatolactin: assessment of in vivo metabolic effects. Mar. Biotechnol. 5, 92–101. Wang, J., Yu, L., Schmidt, R.E., Su, C., Huang, X., Gould, K., Cao, G., 2005. Characterization of HSCD5, a novel human stearoyl-CoA desaturase unique to primates. Biochem. Biophys. Res. Commun. 332, 735–742. Zerai, D.B., Fitzsimmons, K.M., Collier, R.J., 2010. Transcriptional response of delta-9desaturase gene to acute and chronic cold stress in Nile tilapia, Oreochromis niloticus. J. World Aquacult. Soc. 41, 800–806. Zhang, H., Zhang, X., Wang, Z., Dong, X., Tan, C., Zou, H., Peng, Q., Xue, B., Wang, L., Dong, G., 2014. Effects of dietary energy level on lipid metabolism-related gene expression in subcutaneous adipose tissue of Yellow breed × Simmental cattle. Anim. Sci. J. http://dx.doi.org/10.1111/asj.12316. Zhang, D.L., Han, F., Yu, D.H., Xiao, S.J., Li, M.Y., Chen, J., Wang, Z.Y., 2015. Characterization of E3 ubiquitin ligase neuregulin receptor degradation protein-1 (Nrdp1) in the large yellow croaker (Larimichthys crocea) and its immune responses to Cryptocaryon irritans. Gene 556, 98–105. Zheng, Y., Prouty, S.M., Harmon, A., Sundberg, J.P., Stenn, K.S., Parimoo, S., 2001. Scd3-a novel gene of the stearoyl-CoA desaturase family with restricted expression in skin. Genomics 71, 182–191.