- Email: [email protected]
T-2 toxin in the diet suppresses growth and induces immunotoxicity in juvenile Chinese mitten crab (Eriocheir sinensis)
Fish and Shellfish Immunology 97 (2020) 593–601
Contents lists available at ScienceDirect
Fish and Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
T-2 toxin in the diet suppresses growth and induces immunotoxicity in juvenile Chinese mitten crab (Eriocheir sinensis)
T
Chunling Wanga, Xiaodan Wanga,∗, Shusheng Xiaoa, Xianyong Bua, Zhideng Lina, Changle Qia, Jian G. Qinb, Liqiao Chena,∗∗ a b
Laboratory of Aquaculture Nutrition and Environmental Health, School of Life Sciences, East China Normal University, 500 Dongchuan Rd, Shanghai, 200241, China School of Biological Sciences, Flinders University, Adelaide, SA, 5001, Australia
A R T I C LE I N FO
A B S T R A C T
Keywords: T-2 toxin Eriocheir sinensis juvenile Immunotoxic Growth Hepatopancreas
The T-2 toxin is a trichothecene mycotoxin and is highly toxic to aquatic animals, but little is known on its toxic effect in crustaceans. In the present study, the crab juveniles were fed with diets containing four levels of T-2 toxin: 0 (control), 0.6 (T1), 2.5 (T2) and 5.0 (T3) mg/kg diet for 56 days to evaluate its impact on the juvenile of Chinese mitten crab (Eriocheir sinensis). The crabs fed the T-2 toxin diets had significantly lower weight gain and specific growth rate than those fed the control diet. Moreover, crab survival in T3 group was obviously lower than that in the control. Oxidative stress occurred in all the treatment groups as indicated by higher activities of total superoxide dismutase, glutathione peroxidase, and total antioxidant capacity than those in the control. The total hemocyte count, respiratory burst, phenoloxidase in the hemolymph, and phenoloxidase, acid phosphatase and alkaline phosphatase in the hepatopancreas of crabs fed T-2 toxin were significantly lower than those in the control. The transcriptional expressions of lipopolysaccharide-induced TNF-alpha factor, relish, and the apoptosis genes in the hepatopancreas were induced by dietary T-2 toxin. The genes related to detoxication including cytochrome P450 gene superfamily and glutathione S transferase were induced in low concentration, then decreased in high concentration. Dietary T-2 toxin damaged the hepatopancreas structure, especially as seen in the detached basal membrane of hepatopancreatic tubules. This study indicates that dietary T-2 toxin can reduce growth performance, deteriorate health status and cause hepatopancreas dysfunction in crabs.
1. Introduction T-2 toxin is one of the trichothecenes that are a secondary metabolites produced by various fungus species of the genus Fusarium. This toxin is stable in various environmental conditions even by autoclavation and can cause adverse impact such as growth retardation, hepatic damage, immunotoxicity and blood cell reduction [1–4]. The WHO and FAO have listed T-2 toxin a dangerous source of food pollution in nature since 1973 [5]. Because T-2 toxin commonly contaminates grain products including maize, wheat and oats all over the world especially at high temperature and high moisture regions during cultivation and storage [6]. In recent years, the replacement of fish meal by plant proteins has been accepted as a reality, which increases the risk of mycotoxin contamination such as T-2 toxin in aquatic feed [7]. Therefore, considering the danger and economic loss of T-2 toxin in aquaculture, we face an urgent need to understand the toxic effects of T-2 toxin in aquaculture through feed.
∗
Previous studies have revealed that T-2 toxin can cause growth inhibition, low survival, hepatic injury and immunotoxicity in aquatic animals [8–10]. When the diet is contaminated by T-2, even as low as 0.5 mg/kg, shrimp reduce weight gain [8]. T-2 exposure can also cause weight reduction and kidneys injury in channel catfish [10]. In addition, an exposure to dietary T-2 toxin can exert oxidative stress by increasing the production of free radicals in fish and chicken [7,11]. Furthermore, T-2 toxin can cause immune system damage, inflammation response and apoptosis in Pacific white shrimp, rats and zebrafish [12–14]. Exposure to 0.1 μmol/L or more of T-2 toxin can cause cell apoptosis mainly around the tail area [14]. The dose of 5.3 mg/kg dietary T-2 toxin would decrease non-specific immunity with a reduction of blood cells and an increase of inflammatory cytokines in carp [15]. Apart from the impact of economic loss in aquaculture, dietary T-2 can affect the quality of edible meat of aquatic animals by trace residues. The levels of 17.52 ± 2.87 ng/g and 48.61 ± 3.13 ng/g of
Corresponding author. LANEH, School of Life Sciences, East China Normal University, Dongchuan Road, 200241, Shanghai, PR China. Corresponding author. LANEH, School of Life Sciences, East China Normal University, Dongchuan Road, 200241, Shanghai, PR China. E-mail addresses: [email protected] (C. Wang), [email protected] (X. Wang), [email protected] (L. Chen).
∗∗
https://doi.org/10.1016/j.fsi.2019.12.085 Received 13 August 2019; Received in revised form 23 December 2019; Accepted 27 December 2019 Available online 28 December 2019 1050-4648/ © 2019 Elsevier Ltd. All rights reserved.
Fish and Shellfish Immunology 97 (2020) 593–601
C. Wang, et al.
modified-masked toxins (mT-2s) were found in the hepatopancreas of shrimp following exposure to different levels of T-2 toxin for 20 d, posing a potential health risk to consumers [8]. It is therefore necessary to understand the detoxification mechanism to alleviate the toxic effects of T-2 toxin and ensure seafood safety to consumers. The liver is the main detoxifying organ for T-2 toxin [16,17] and the cytochrome p450 enzymes (phase Ι) and glutathione-S-transferase (phase Π) in the liver play an important role in biotransformation and detoxification of xenobiotics such as T-2 toxin [18,19]. The Chinese mitten crab, Eriocheir sinensis, is a native and important freshwater economic species and its nutrition requirement for growth performance [20–22], metabolism [23,24], immunity [25–27] and disease resistance [28–30] have been well documented. However, little is known on the impact of toxic materials from feed of crabs. A recent study shows that environmental toxin such as benzo[a]pyrene (BaP) can disturb immune system more than metabolic system in crabs [26]. In the diet ingredients of crabs such as maize and wheat are easily contaminated by mycotoxins like T-2 toxin [31]. Up to date, the impacts of T-2 toxin on other aquatic animals such as Pacific white shrimp [8], black tiger shrimp [9] and rainbow trout [32] have been reported, but no data have been reported on its toxicity in crabs. Therefore, in the present study, the effects of the T-2 toxin on growth performance, oxidative stress, immune function and biotransformation enzyme activities were investigated in the juvenile of Chinese mitten crab to gain insight into the T-2 toxic effect and its influence on meat quality in crabs.
Table 1 Formulation and proximate composition of experimental diets (g kg−1 dry basis). Ingredients
C
T1
T2
T3
Fish meal Casein Gelatine Corn starch Fish oil Soybean oil Vitamin premixa Mineral premixb Cholesterol Soylecithin CMC Choline chloride Betaine Cellulose BHT T-2 toxin(mg) Total Moisture Crude protein Crude lipid Ash T-2 toxin (mg/kg)
230 213 68 250 20 20 30 30 5 10 20 5 10 88.5 0.5 0 1000 82.4 402.0 60.7 78.8 0
230 213 68 250 20 20 30 30 5 10 20 5 10 88.5 0.5 0.625 1000 86.0 405.2 61.6 75.2 0.5
230 213 68 250 20 20 30 30 5 10 20 5 10 88.5 0.5 2.5 1000 83.7 401.8 63.3 78.8 2.0
230 213 68 250 20 20 30 30 5 10 20 5 10 88.5 0.5 5 1000 83.9 403.3 61.6 80.3 4.6
a Vitamin premix (per 100 g premix): retinol acetate, 0.043 g; thiamin hydrochloride, 0.15 g; riboflavin, 0.0625 g; Ca pantothenate, 0.3 g; niacin, 0.3 g; pyridoxine hydrochloride, 0.225 g; para-aminobenzoic acid, 0.1 g; ascorbic acid, 0.5 g; biotin, 0.005 g; folic acid, 0.025 g; cholecalciferol, 0.0075 g; αtocopherol acetate, 0.5 g; menadione, 0.05 g; inositol, 1 g. All ingredients are filled with α-cellulose to 100 g. b Mineral premix (per 100 g premix): KH2PO4, 21.5 g; NaH2PO4, 10.0 g; Ca (H2PO4)2, 26.5 g; CaCO3, 10.5 g; KCl, 2.8 g; MgSO4·7H2O, 10.0 g; AlCl3·6H2O, 0.024 g; ZnSO4·7H2O, 0.476 g; MnSO4·6H2O, 0.143 g; KI, 0.023 g; CuCl2·2H2O, 0.015 g; CoCl2·6H2O, 0.14 g Calcium lactate, 16.50 g; Fe-citrate, 1 g. All ingredients are diluted with α-cellulose to 100 g.
2. Materials and methods 2.1. Experimental diets Four practical diets were formulated with different concentrations of T-2 toxin: 0 (control), 0.6 (T1), 2.5 (T2), 5.0 (T3) mg/kg diet, which were designed according to the LC50 of juvenile Pacific white shrimp at the same specification as the crabs we use [8]. The ingredients and proximate composition are presented in Table 1. The T-2 toxin crystalline (Pribolab Pte, Ltd. Singapore; purity > 98%) was dissolved in ethanol and added to the diet. Same amount of ethanol was also added to the control diet. The mixtures were subsequently blended and extruded into 2.5-mm-diameter pellets by a double helix plodder (F-26, SCUT industrial factory, Guangdong, China). Through the extruding process, the extrusion temperature and gelatin and sodium carboxymethyl cellulose pellets in the diets improved the starch digestibility and water stability of diets. These pellets were air-dried to < 10% moisture and stored at −20 °C until use. The proximate composition analysis of diets was analyzed according to the Association of Official Analytical Chemists (AOAC) procedures [33]. Moisture content was analyzed by drying the samples at 105 °C until a constant weight. Crude protein was measured by the Kjeldahl method using Kjeltec™ 8200 (Kjeltec, Foss, Sweden). Lipid was determined by the method of soxhlet apparatus with allihn condenser. Ash content were analyzed by burning the dry samples in a muffle furnace (PCD-E3000 Serials, Peaks, Japan) at 550 °C for 5 h. And T-2 toxin content is detected by liquid chromatography-tandem mass spectrometry methods (LC-MS/MS) [34].
daily at 08:00 and 18:00 for 8 weeks. Two hours after feeding, the uneaten feed and feces were siphoned out. Dead crabs were weighed and recorded during the experiment. The water condition was maintained at 26.0 ± 1.0 °C, 8.5 ± 1.0 mg/L dissolved oxygen and 7.5 ± 0.4 pH throughout the experiment. During the trial, the water was exchanged at 30% of the tank volume daily and natural light-dark cycle was used.
2.3. Sample collection At the end of the 8-week feeding trial, all the crabs were fasted for 24 h, and then the crabs of each bucket were counted and weighed. Crabs were subsequently anaesthetized with ice slurry and then hemolymph was taken with a 1-mL syringe from the joints of walking legs. One part of hemolymph was placed at 4 °C for 24 h and centrifuged at 4500 rpm and 4 °C (5415 R, Eppendorf, Germany) for 10 min to get the serum which was stored at −80 °C for enzyme analysis. The other part was diluted with an equal volume of anticoagulant solution (0.1 M glucose, 30 mM citrate, 26 mM citric acid, 0.14 M NaCl, 10 mM EDTA) to count the numbers of total hemocytes (THC) and determinate the respiratory burst. The hepatopancreas of crabs from each group were quickly separated. Six of hepatopancreas were weighed in a group for calculating the hepatosomatic index. Three of them were fixed in 4% paraformaldehyde for histological analysis and the rest were stored at −80 °C for further analysis of gene expressions and enzymatic activities. All research protocols on live crabs in this study were approved by the Committee on the Ethics of Animal Experiments of East China Normal University.
2.2. Experimental crab and feeding management The juvenile crabs were obtained from a local farm in the Chongming County, Shanghai, China. Crabs were acclimated for 7 days before the experiment. A total of 700 crabs (mean weight 2.00 ± 0.05 g) were randomly divided into four groups with five replicates and thirty-five crabs each in plastic buckets (200 L, 82 × 62 × 58 cm). In each bucket, four arched tiles and six groups of plastic pipes (12 cm long and 3 cm diameter, six pipes per group) were used to reduce attacking. All crabs were fed to apparent satiation twice 594
Fish and Shellfish Immunology 97 (2020) 593–601
C. Wang, et al.
Table 2 Primer pair sequences for real-time qPCR in Chinese mitten crab. Target gene
Primer sequence forward(5’ - 3′)
Primer sequence reverse(5’ - 3′)
Length (bp)
Tm (°C)
LITAF Relish CYP2 CYP3 CYP4 GST Bax Bcl-2 caspase-8 caspase-3 CncC β-actin
TAAAGGCAAGGGAGGCTTCG TCAGGATTCGGTGGCAACTC ACCGCCGCTTCACCTTAC CTCCACGACTACAAGATGTTACGC AAGACTTCGTGGAGGTGTTC CTGTCATCACCATAAAGAAGGCCA GTCAGTGAACCTCAGCTGCAT ATAAGGTGGTTCGCTCCGTC CATGGTGATGAGAATGAC CATTCGCCAGCCTTGCCCACA GCATCCTTCTGGTACCTCGTT CAGGAAATGACCACTGCCGC
GAATGGAGCTTGAGGTGGCA ATCTGCACTTGGACCGATGG CTTGCTTGCCACCATCTGC CACCTCGTTCATGGTAAAGAGC GCACAGCGTTATGTTGGTGAAG CGCCCTGCTCATTCATGTCATAT CACAGCCACATCACCCACGAA TTAACACAGTCCGAGGCCAG TTGGATGAAGTAGAGACG TCTGTCGTGGTTCCTTGTAGCCTT CACTGCTTTGGCTCATCCTTG CGGAACCTCTCATTGCCGA
97 105 188 90 107 114 124 121 120 94 91 95
60.0 60.5 60.3 59.7 59.8 59.6 59.0 59.5 60.2 61.0 60.3 60.8
LITAF: lipopolysaccharide induced TNF factor, CYP2: cytochrome P450, family 2, CYP3: cytochrome P450, family 3, CYP4: cytochrome P450, family 4, GST: glutathione -S-transferase, CncC, cap'n'collar transcription factor.
2.4. Growth performance, survival and hepatosomatic index
an increase in absorbance of 0.001/min.
At the end of the feeding trial, weight gain (WG), specific growth rate (SGR), survival rate (SR) and the hepatosomatic index (HSI) were calculated as follows:
2.6. RT-qPCR analysis in hepatopancreas tissues Total RNA of the hepatopancreas was isolated using Trizol (RN0101, Aidlab, China) following the manufacturer's instructions. The quantity and concentration of total RNA were measured by the Nanodrop 2000 (Thermo, USA). Then the cDNA was synthesized by the reverse transcription kit (KR116, Tiangen Biotech, China) and kept at −20 °C for real-time quantitative PCR (RT-qPCR). The RT-qPCR was performed in the CFX96TM Real-Time system (Bio-Rad, Hercules, CA, USA) with a SYBR kit (PC3302, Aidlab, China). The qPCR reactions were carried out in a final volume of 20 μL, containing 10 μL SYBR mixture, 0.4 μL (10 μM) forward and reverse primers, 8.2 μL H2O and 1 μL cDNA template. The reaction programs were set at 95 °C for 2 min, 40 cycles of 95 °C for 5 s and 60 °C for 30 s with the melt curve ananlysis for 95 °C for 5 s and 0.5 °C per 5 s increment from 65 °C to 95 °C. Relative expression levels were calculated by the 2−ΔΔCT method as described [36] with β-actin as the housekeeping gene. Oligo nucleotide primers were designed using the Oligo 7 (Table 2).
Weight gain (%) = (final weight – initial weight) × 100 / initial weight; Specific growth rate (%/d) = (Ln final weight – Ln initial weight) × 100 /days; Survival rate (%) = Final crab number/ Initial crab number × 100; Hepatosomatic index (%) = (wet hepatopancreatic weight / wet body weight) × 100
2.5. Biochemical assay 2.5.1. Total hemocyte count (THC) measurement The hemocytes were counted on a phase contrast microscope (Nikon TS100, Japan) with a drop of hemolymph-anticoagulant mixture on the hemocytometer.
2.7. Histopathological analysis on the hepatopancreas The hepatopancreas tissue samples were immediately fixed in 4% paraformaldehyde for 24 h, and then dehydrated in a graded series of ethanol (50%–95%) and embedded in paraffin. The 5-μm thickness sections were obtained using a microtome and stained with hematoxylin/eosin (H&E). Histopathological changes were observed on an Axioskop microscope (BX51, Olympus, Tokyo, Japan).
2.5.2. Respiratory burst activity Respiratory burst of the hemolymph was measured using the nitroblue-tetrazolium (NBT; Sangon Biotech Co., Ltd., China) assay following the method of Anderson and Siwicki [35]. Briefly, 100 μL anticoagulant and hemolymph mixture was mixed with 0.1 mL 0.2% NBT solution and incubated for 30 min at room temperature. The N, N-dimethyl formamide (DMF; Sangon Biotech Co., Ltd., China) was added into the mixture and the optical density (OD) of supernatant was measured using a microplate reader at 540 nm with DMF as the blank.
2.8. Statistical analyses All data were statistically analyzed using SPSS statistics 20 (IBM, Armonk, NY, USA) with one-way analysis of variance (ANOVA) and the differences were analyzed among groups by Duncan's multiple-comparison test. A value of P < 0.05 was set as a significant difference.
2.5.3. Enzymatic analysis Acid phosphatase (ACP), alkaline phosphatase (AKP), malondialdehyde (MDA), total superoxide dismutase (T-SOD), total antioxidant capacity (T-AOC), catalase (CAT) and glutathione peroxidase (GPx) activities were detected according to the manufacturer's instructions of commercial kits (Cat. No. A060–2, A059–2, A003–1, A001–1, A015–2, A007-1-1 and A005, Nanjing Jiancheng Bioengineering Institute, China). The phenoloxidase (PO) was evaluated spectrophotometrically using L-DOPA (A610407, Sangon Biotech Co., Ltd., China) as the substrate in a 96-well plate following the method described by Ashida (1971). The enzyme activity was measured at the absorbance of 490 nm wavelength using a microplate reader in an interval of 2 min for 20 min. The PO activity was defined as the amount of enzyme yielding
3. Result 3.1. Growth performance and survival At the end of the 8-week feeding trial, weight gain and specific growth rate significantly decreased in the T-2 toxin treatment groups (P < 0.05) (Fig. 1A and B) compared with those in the control. The lowest survival was observed in the T3 group with 5 mg/kg dietary T-2 toxin (P < 0.05) (Fig. 1E). No significant differences were observed in feed intake and hepatosomatic index among all groups (P > 0.05) 595
Fish and Shellfish Immunology 97 (2020) 593–601
C. Wang, et al.
Fig. 1. Growth performance and survival rate of crabs fed different concentrations of T-2 toxin for 56 days. A. Weight gain; B. Specific growth rate; C. Feed intake; D. Hepatosomatic index; E. Survival rate. Different letters show significant differences among treatments (P < 0.05).
(P < 0.05) (Fig. 3C and F). Dietary T-2 toxin significantly downregulated the ACP and AKP activities in the hepatopancreas (P < 0.05) (Fig. 3G and H), while in the hemolymph, no significant difference was found in ACP and AKP activities among all the groups (P > 0.05) (Fig. 3D and E).
(Fig. 1C and D). 3.2. Antioxidant status in hepatopancreas As shown in Fig. 2, the hepatopancreas MDA content, activities of TSOD, GPx and T-AOC and CncC (cap ‘n’ collar isoform-C) gene expression were significantly affected by dietary T-2 toxin in a dose-dependent manner after the 8-week feeding trial (P < 0.05). Compared with the control, a significant increase in hepatopancreatic MDA and depression of hepatopancreatic T-SOD, GPx, T-AOC and CncC were observed in the T-2 groups (P < 0.05).
3.4. Expression of inflammation-related genes in hepatopancreas The expression of LITAF and relish were significantly upregulated in T3 group compared with the control (P < 0.05) (Fig. 4A). Furthermore, the ALF1 gene expression in T1 group was significantly higher than that in control (P < 0.05) (Fig. 4C). The mRNA level of ALF2 in groups T1 and T2 were markedly higher than those in the control (P < 0.05) (Fig. 4D).
3.3. Enzyme activities of non-specific immunity in hemolymph and hepatopancreas
3.5. Expression of genes associated with apoptosis
THC and respiratory burst activity in the hemolymph significantly decreased compared to the control (P < 0.05) (Fig. 3A and B). Furthermore, the PO activity in the hemolymph and hepatopancreas significantly decreased in the crabs fed T-2 toxin supplementation
Compared with the control, the expression of the caspase-3 gene was significantly increased in the T1 and T3 groups (P < 0.05) Fig. 2. The content of malondialdehyde (MDA) (A), activities of total superoxide dismutase (TSOD) (B), glutathione peroxidase (GPx, GSH-Px) (C) and total antioxidant capacity (T-AOC) (D) and CncC (E) gene expression in the hepatopancreas of crabs fed different concentrations of T-2 toxin for 56 days. Different letters show significant differences among treatments (P < 0.05).
596
Fish and Shellfish Immunology 97 (2020) 593–601
C. Wang, et al.
Fig. 3. Total hemocyte count (THC) (A), respiratory burst (B), phenoloxidase (PO) (C), acid phosphatase (ACP) (D) and alkaline phosphatase (AKP) (E) in hemolymph and phenoloxidase (PO) (F), acid phosphatase (ACP) (G) and alkaline phosphatase (AKP) (H) in hepatopancreas of crabs exposed to different concentrations of T-2 toxin for 56 days. Different letters show significant differences among treatments (P < 0.05).
3.7. Hepatopancreas morphology Compared to the control, the volume of B cell increased, and the number of the R cell decreased in the T-2 toxin group. With the increase of dietary T-2 toxin, the basal membrane of hepatopancreatic tubules was seriously detached and the lumen space was enlarged in the T3 group (Fig. 7).
4. Discussion In the present study, dietary T-2 toxin depressed the growth of juvenile E. sinensis, which is consistent with previous studies on Litopenaeus vannamei [8,37]. The low survival of crabs fed 4.6 mg/kg T2 toxin indicates that the health status of crabs is affected by T-2 toxin. Similarly, a marked reduction in survival was also reported in Pacific white shrimp [8] and rainbow trout [32]. A previous study suggests that reactive oxygen species (ROS) can intensify the toxicity induced by T-2 toxin [38]. The excessive ROS reacts with biological molecules such as lipids, causing lipid peroxidation, and this process can be measured by the content of MDA [39]. According to the present result, the MDA content in hepatopancreas increased when the crabs were fed with T-2 toxin, suggesting that lipid peroxidation is a response in E. sinensis to dietary T-2 toxin. At the same time, T-2 toxin decreased antioxidant enzyme activities (T-SOD, GPx and T-AOC), suggesting that T-2 toxin could attenuate antioxidant capacity in crabs. The T-SOD and GPx are both critical anti-oxidative enzymes with the function of scavenging ROS, and T-AOC is an important index to evaluate the antioxidative status [40]. Moreover, antioxidases could be regulated by the key nucleus transcription factor, nuclear erythroid 2-related factor (Nrf2) to ameliorate oxidative stress in vertebrates [41]. In invertebrates, the CncC gene is orthologous to the vertebrate Nrf2 gene [42]. In this study, the CncC gene expression in the hepatopancreas decreased in the crab fed T-2, suggesting that T-2 toxin could suppress the Nrf2 signal pathway. Furthermore, the activities of antioxidases were positively correlated with Nrf2 gene expression [43], which confirms that T-2 toxin can suppress the antioxidases by inhibiting the Nrf2 signal pathway and suggest that T-2 toxin can impair the anti-oxidative ability and cause oxidative damage in the hepatopancreas of juvenile crabs. Crustaceans lack adaptive immunity and depend solely on the non-
Fig. 4. Relative Lipopolysaccharide-induced tumor necrosis factor-alpha factor (LITAF) (A), relish (B), Anti-lipopolysaccharide factor 1 (ALF1) (C) and Antilipopolysaccharide factor 2 (ALF2) (D) mRNA expression in the hepatopancreas of crabs exposed to different concentrations of T-2 toxin for 56 days. Different letters show significant differences among treatments (P < 0.05).
(Fig. 5A). The expressions of the caspase-8 gene and Bax were significantly increased in T3 group (P < 0.05) (Fig. 5B and C), while expression of Bcl-2 gene was significantly increased in group T1 (P < 0.05) (Fig. 5D).
3.6. Detoxification The mRNA expressions of CYP2, CYP3 and CYP4 in T1 group were higher than in other groups (Fig. 6A, B and 6C). The mRNA level of GST in T2 group was significantly higher than that in the control and T1 or T3 group (P < 0.05) (Fig. 6D).
597
Fish and Shellfish Immunology 97 (2020) 593–601
C. Wang, et al.
Fig. 5. Relative caspase-3 (A), caspase-8 (B), Bax (C) and Bcl-2 (D) mRNA expression and the ratio of Bax/Bcl-2 in the hepatopancreas of crabs exposed to different concentrations of T-2 toxin for 56 days. Different letters show significant differences among treatments (P < 0.05).
and AKP activities of hepatopancreas and PO activities of hepatopancreas and hemolymph in all T-2 toxin additive groups were significantly decreased compared to the control, indicating that dietary T-2 toxin can disable the response to xenobiotics or pathogen. Therefore, these results reveal that dietary T-2 toxin might be detrimental to the innate immune system of E. sinensis. The immune function is also associated with the inflammatory response related to pro-inflammatory cytokines modulated by the transcription factors LITAF and NF-κB [51,52]. In crustaceans, relish is an important member of the NF-κB family, and can induce pro-inflammatory cytokines expression [53]. Moreover, LITAF, as a transcription factor, has a similar function as NF-κB to regulate the expression of TNF-α, a mediator of inflammation [54]. In the present study, the expression of LITAF and relish genes was induced by T-2 toxin in T3 group, indicating that a high concentration of T-2 toxin may induce inflammation in the hepatopancreas of crabs. In addition, ALF1 and ALF2 are important antimicrobial polypeptides and can modulate inflammatory responses by downregulating the release of pro-inflammatory cytokines [55]. After T-2 toxin exposure, ALF1 and ALF2 gene expressions in the hepatopancreas were induced in T1 group and then decreased in T2 and T3 groups with the dose increase of T-2 toxin in the diet. These results suggest that crabs have an adaptability to T-2 toxin stress initially, but the high concentrations T-2 toxin impede the recovery of homoeostasis. The changes of ALF1 and ALF2 gene expressions further prove the occurrence of inflammation in the hepatopancreas induced by T-2 toxin. The oxidative damage can contribute to cell apoptosis in grass carp [56]. This study demonstrates that T-2 toxin resulted in oxidative stress in the hepatopancreas of crabs, suggesting that T-2 toxin may cause cell apoptosis in the hepatopancreas. Other studies show that apoptosis can be initiated mainly by the death receptor pathway (caspase-8) and mitochondrial apoptosis pathway (caspase-3) in mammalian regulated by up-regulating the transcription of pro-apoptotic genes (such as Bax) and anti-apoptotic genes (such as Bcl-2) [57,58]. Bax promotes apoptosis by homodimerizing or heterodimerizing Bcl-2 and the ratio of Bax/Bcl-2 to determine the progress of cell apoptosis [59]. In the present study, apoptosis was characterized by activation of caspase-3, caspase-8 and Bax gene expressions, and inhibition of Bcl-2 gene expression induced by T-2 toxin even at the lowest T-2 concentration (0.5 mg/kg) in the hepatopancreas. These results suggest that apoptosis in the hepatopancreas after T-2 toxin intake is proceeded via both
Fig. 6. Relative CYP2 (A), CYP3 (B), CYP4 (C) and GST (D) mRNA expression in hepatopancreas of crabs exposed to different concentrations of T-2 toxin for 56 days. Different letters show significant differences among treatments (P < 0.05).
specific immune system including against invading microbes [44]. Hematological parameters such as hemolymph cell counts and respiratory burst activity are important for evaluating immune functions [45]. The hemolymph cell count includes semi-granular cells involved in phagocytosis and large granular cells participated in the storage and release of PO, which is a sensitive indicator to reflect the immune status of invertebrates [46,47]. The respiratory burst activity is connected with the mechanism that pathogens and parasites are eliminated following phagocytosis [48]. In this study, the decrease of total hemocyte counts (THCs) and respiratory burst activity following T-2 toxin exposure may be due to the inhibition of mobilization or apoptosis of hemocytes caused by T-2 toxin. Moreover, ACP, AKP, PO activities can reflect the innate immune capacity with important functions of elimination of extracellular invaders [49,50]. In the present study, the ACP 598
Fish and Shellfish Immunology 97 (2020) 593–601
C. Wang, et al.
Fig. 7. Hepatopancreas histopathology of crabs exposed to T-2 toxin for 56 days (H&E 20 x). A-D represent the control, group T1, group T2 and group T3. B: B cells (secretory cells); R: R cell (storage cells). Two-head arrows indicate separation between the myoepithelial layer and the epithelium. Scale bar = 50 μm.
similar observation was reported in a previous study in which diclofenac could activate CYP450 gene expression [66]. This indicates that CYP450 genes may play an important role in catalyzing detoxification of T-2 toxin. In addition, the phase I metabolites are further metabolized by phase II enzyme glutathione S transferase (GST), and play important roles in the detoxification of toxic endogenous substrates in almost all living organisms to produce water-soluble conjugates and make them easier to excrete [67–69]. The most significantly increased hepatopancreatic GST gene expression in T2 group was observed in our study, which probably represents a detoxification response to T-2 exposure. These results are in accordance with a study conducted by Wang et al. [70], who observed an increase at the low dose and a decrease at the high dose of GST activity after exposing Daphnia magna to ibuprofen. Presumably, the upregulations of GST and CYP450 in T1 and T2 may be due to the defense response of crabs and prompt to protecting themselves at a low T-2 dose. The biotransformation system was impaired at high T-2 doses.
mitochondrial apoptotic pathway and death receptor pathway regulated by the Bax/Bcl-2 ratio. The hepatopancreas in crustacean functions as the liver, pancreas, and intestine in vertebrates and plays a critical role in metabolism, nutrient absorption, and immune function [60]. Therefore, it serves as a critical target organ when crabs are exposed to T-2 toxin [8]. Thereby, histopathological alternations of the hepatopancreas could be used to evaluate T-2 toxin toxicity. In the current study, the T-2 toxin at different doses caused considerable histological damage of the hepatopancreas, including B cell dilatation, degenerated R cells and detached basal membrane of hepatopancreatic tubules. Similar histological variations in the hepatopancreas of L. vannamei were also reported by Wang et al. [61] after exposure to aflatoxin B1. This suggests that T-2 toxin can potentially cause an injury and affect physiological functions of the hepatopancreas at the tissue and organ levels. In general, hepatopancreas is the main detoxifying organ for xenobiotics [62]. When animals are exposed to xenobiotic, the biotransformation process in the hepatopancreas is activated for detoxification mediated by the phase I and phase II biotransformation system [63]. In phase I system, xenobiotic or toxin could be metabolized by facilitating bioactivation of the multi-enzymatic system cytochrome P450 (CYP450) gene superfamily. The CYP450 has been identified as a key enzyme in the metabolism of T-2 toxin, and can transform T-2 toxin into 3′–OH–T-2 toxin highly expressed in the liver [64]. Moreover, The CYP2, CYP3 and CYP4 subfamilies have important roles in xenobiotic metabolism in crustaceans [65]. In the present study, the expression of CYP450 homologous genes was significantly induced in the T1 group, and then gradually decreased with the increase of T-2 toxin concentration, displaying a dose-dependent responding relationship. A
5. Conclusion In the present study, the toxic effects of T-2 toxin on E. sinensis was evaluated for the first time. Our data show that the decrease in growth performance and impairment of immune function induced by T-2 toxin might partially be due to (1) oxidative damage caused by ROS and reduction of antioxidase activity associated with the inhibition of CncC gene expression; (2) inflammation, cell apoptosis and hepatopancreatic injury; and (3) reduction in detoxification capacity including the phase I and phase II biotransformation system. These data provide a better insight into the understanding of molecular toxic mechanisms of T-2 599
Fish and Shellfish Immunology 97 (2020) 593–601
C. Wang, et al.
toxin. Our results alert to the awareness of the ecological risks of T-2 toxin in aquatic feed.
[21]
Declaration of competing interest [22]
The authors declare no conflict of interest. Acknowledgements
[23]
This work was supported by Shanghai Sailing Program (Grant No. 18YF1406500), “Chenguang Program” supported by Shanghai Education Development Foundation and Shanghai Municipal Education Commission (Grant No. 17CG26), the National Natural Science Foundation of China (Grant No. 31572629), Agriculture Research System of Shanghai, China (Grant No. 201804) and China Agriculture Research System-48 (CARS-48).
[24]
[25]
[26]
References
[27]
[1] L.C. Yang, D. Tu, Z.Y. Zhao, J. Cui, Cytotoxicity and apoptosis induced by mixed mycotoxins (T-2 and HT-2 toxin) on primary hepatocytes of broilers in vitro, Toxicon 129 (2017) 1–10. [2] S. Marin, A.J. Ramos, G. Cano-Sancho, V. Sanchis, Mycotoxins: occurrence, toxicology, and exposure assessment, Food Chem. Toxicol. 60 (2013) 218–237. [3] Q.F. Wan, G.Y. Wu, Q.H. He, H.R. Tang, Y.L. Wang, The toxicity of acute exposure to T-2 toxin evaluated by the metabonomics technique, Mol. Biosyst. 11 (3) (2015) 882–891. [4] L. Escriva, G. Font, L. Manyes, In vivo toxicity studies of fusarium mycotoxins in the last decade: a review, Food Chem. Toxicol. 78 (2015) 185–206. [5] Z.R. Huang, Y.L. Wang, M. Qiu, L.J. Sun, J.M. Liao, R.D. Wang, X.D. Sun, S.Y. Bi, R. Gooneratne, Effect of T-2 toxin-injected shrimp muscle extracts on mouse macrophage cells (RAW264.7), Drug Chem. Toxicol. 41 (1) (2018) 16–21. [6] M. Adhikari, B. Negi, N. Kaushik, A. Adhikari, A.A. Al-Khedhairy, N.K. Kaushik, E.H. Choi, T-2 mycotoxin: toxicological effects and decontamination strategies, Oncotarget 8 (20) (2017) 33933–33952. [7] H. Modra, E. Sisperova, J. Blahova, V. Enevova, P. Fictum, A. Franc, J. Mares, Z. Svobodova, Elevated concentrations of T-2 toxin cause oxidative stress in the rainbow trout (Oncorhynchus mykiss), Aquacult. Nutr. 24 (2) (2018) 842–849. [8] Y.J. Deng, Y.L. Wang, X.D. Zhang, L.J. Sun, C.J. Wu, Q. Shi, R.D. Wang, X.D. Sun, S.Y. Bi, R. Gooneratne, Effects of T-2 toxin on Pacific white shrimp Litopenaeus vannamei: growth, and antioxidant defenses and capacity and histopathology in the hepatopancreas, J. Aquat. Anim. Health 29 (1) (2017) 15–25. [9] O. Bundit, H. Kanghae, W. Phromkunthong, K. Supamattaya, Effects of mycotoxin T-2 and zearalenone on histopathological changes in black tiger shrimp (Penaeus monodon Fabricius), Songklanakarin J. Sci. Technol. 28 (2006) 937–949. [10] B.B. Manning, M.H. Li, E.H. Robinson, Response of channel catfish to diets containing T-2 toxin, J. Aquat. Anim. Health 15 (2003) 229–238. [11] M. Nakade, C. Pelyhe, B. Kovesi, K. Balogh, B. Kovacs, J. Szabo-Fodor, E. Zandoki, M. Mezes, M. Erdelyi, Short-term effects of T-2 toxin or deoxynivalenol on glutathione status and expression of its regulatory genes in chicken, Acta Vet. Hung. 66 (1) (2018) 28–39. [12] P.L. Lu, Y.L. Wang, Z. Dai, L.J. Sun, D.F. Xu, Y. Liu, R.Y. Ye, R. Gooneratne, S.Y. Bi, Selection and evaluation of indexes commonly used to determine contamination with T-2 toxin in Pacific white shrimp Litopenaeus vannamei by the grey relational method, J. Aquat. Anim. Health 29 (3) (2017) 129–135. [13] M.R. Kazem Ahmadi, Effects of T-2 toxin on cytokine production by mice peritoneal macrophages and lymph node T-cells., Iran, J. Immunol. 5 (3) (2008) 177–180. [14] G.G. Yuan, Y.M. Wang, X.Y. Yuan, T.F. Zhang, J. Zhao, L.Y. Huang, S.Q. Peng, T-2 toxin induces developmental toxicity and apoptosis in zebrafish embryos, J. Environ. Sci. 26 (4) (2014) 917–925. [15] I. Matejova, M. Faldyna, H. Modra, J. Blahova, M. Palikova, Z. Markova, A. Franc, M. Vicenova, L. Vojtek, J. Bartonkova, P. Sehonova, M. Hostovsky, Z. Svobodova, Effect of T-2 toxin-contaminated diet on common carp (Cyprinus carpio L.), Fish Shellfish Immunol. 60 (2017) 458–465. [16] E. Esteban-Zubero, M.A. Alatorre-Jimenez, L. López-Pingarrón, M.C. ReyesGonzales, P. Almeida-Souza, A. Cantín-Golet, F.J. Ruiz-Ruiz, D.X. Tan, J.J. García, R.J. Reiter, Melatonin's role in preventing toxin-related and sepsis-mediated hepatic damage: a review, Pharmacol. Res. 105 (2016) 108–120. [17] J.C. Medina, J.A. Fierro, J. Lara, V. Brito, M. Forat, The effects of 1.2 ppm T-2 Toxin on performance, lesions, and general health of male broilers and the efficiency of an organoaluminosilicate (mycotoxin binder), J. Dairy Sci. 93 (2010) 282–283. [18] X.H. Ge, J.P. Wang, J. Liu, J. Jiang, H.N. Lin, J. Wu, M. Ouyang, X.Q. Tang, M. Zheng, M. Liao, Y.Q. Deng, The catalytic activity of cytochrome P450 3A22 is critical for the metabolism of T-2 toxin in porcine reservoirs, Catal. Commun. 12 (2) (2010) 71–75. [19] C. Wang, P.J. Ku, X.P. Nie, S. Bao, Z.H. Wang, K.B. Li, Effects of simvastatin on the PXR signaling pathway and the liver histology in Mugilogobius abei, Sci. Total Environ. 651 (Pt 1) (2019) 399–409. [20] F.L. Han, X.D. Wang, J.L. Guo, C.L. Qi, C. Xu, Y. Luo, E.C. Li, J.G. Qin, L.Q. Chen, Effects of glycinin and β-conglycinin on growth performance and intestinal health
[28]
[29]
[30]
[31]
[32] [33]
[34]
[35] [36] [37]
[38]
[39]
[40]
[41]
[42] [43]
[44]
600
in juvenile Chinese mitten crabs (Eriocheir sinensis), Fish Shellfish Immunol. 84 (2019) 269–279. C. Xu, E.C. Li, S. Liu, Z.P. Huang, J.G. Qin, L.Q. Chen, Effects of α-lipoic acid on growth performance, body composition, antioxidant status and lipid catabolism of juvenile Chinese mitten crab Eriocheir sinensis fed different lipid percentage, Aquaculture 484 (2018) 286–292. C. Xu, X.D. Wang, F.L. Han, C.L. Qi, E.C. Li, J.L. Guo, J.G. Qin, L.Q. Chen, α-lipoic acid regulate growth, antioxidant status and lipid metabolism of Chinese mitten crab Eriocheir sinensis: optimum supplement level and metabonomics response, Aquaculture 506 (2019) 94–103. Q.Q. Ma, X.D. Wang, Y.Y. Cui, N.N. Zhang, J.G. Qin, Z.Y. Du, L.Q. Chen, Untargeted GC-MS metabolomics reveals metabolic differences in the Chinese mitten-hand crab (Eriocheir sinensis) fed with dietary palm oil or olive oil, Aquacult. Nutr. 24 (6) (2018) 1623–1637. Q.Q. Ma, Q. Chen, Z.H. Shen, D.L. Li, T. Han, J.G. Qin, L.Q. Chen, Z.Y. Du, The metabolomics responses of Chinese mitten-hand crab ( Eriocheir sinensis ) to different dietary oils, Aquaculture 479 (2017) 188–199. Y.L. Chen, L.Q. Chen, J.G. Qin, Z.L. Ding, M. Li, H.B. Jiang, S.M. Sun, Y.Q. Kong, E.C. Li, Growth and immune response of Chinese mitten crab (Eriocheir sinensis) fed diets containing different lipid sources, Aquacult. Res. 47 (6) (2016) 1984–1995. N. Yu, Q.Q. Ding, E.C. Li, J.G. Qin, L.Q. Chen, X.D. Wang, Growth, energy metabolism and transcriptomic responses in Chinese mitten crab (Eriocheir sinensis) to benzo[α]pyrene (BaP) toxicity, Aquat. Toxicol. 203 (2018) 150–158. J.T. Lu, C.L. Qi, S.M. Limbu, F.L. Han, L. Yang, X.D. Wang, J.G. Qin, L.Q. Chen, Dietary mannan oligosaccharide (MOS) improves growth performance, antioxidant capacity, non-specific immunity and intestinal histology of juvenile Chinese mitten crabs (Eriocheir sinensis), Aquaculture 510 (2019) 337–346. L.G. Wang, L.Q. Chen, J.G. Qin, E.C. Li, N. Yu, Z.Y. Du, Y.Q. Kong, J. Qi, Effect of dietary lipids and vitamin E on growth performance, body composition, anti-oxidative ability and resistance to Aeromonas hydrophila challenge of juvenile Chinese mitten crab Eriocheir sinensis, Aquacult. Res. 46 (10) (2015) 2544–2558. J.J. Wei, F. Zhang, W.J. Tian, Y.Q. Kong, Q. Li, N. Yu, Z.Y. Du, Q.Q. Wu, J.G. Qin, L.Q. Chen, Effects of dietary folic acid on growth, antioxidant capacity, non-specific immune response and disease resistance of juvenile Chinese mitten crab Eriocheir sinensis (Milne-Edwards, 1853), Aquacult. Nutr. 22 (3) (2016) 567–574. Y.L. Chen, W.S. Liu, X.D. Wang, E.C. Li, F. Qiao, J.G. Qin, L.Q. Chen, Effect of dietary lipid source and vitamin E on growth, non-specific immune response and resistance to Aeromonas hydrophila challenge of Chinese mitten crab Eriocheir sinensis, Aquacult. Res. 49 (5) (2018) 2023–2032. Y.L. Yi, F. Zhao, N. Wang, H. Liu, L.J. Yu, A.H. Wang, Y.P. Jin, Endoplasmic reticulum stress is involved in the T-2 toxin-induced apoptosis in goat endometrium epithelial cells, J. Appl. Toxicol. 38 (12) (2018) 1492–1501. H.A. Poston, J.L. Copfin, G.F. Combs Jr., Biological effects of dietary T-2 toxin on Rainbow Trout, Salmo gairdneri, Aquat. Toxicol. 2 (1982) 79–88. N.N. Gabriel, M.R. Wilhelm, H.-M. Habte-Tsion, P. Chimwamurombe, E. Omoregie, Dietary garlic (Allium sativum) crude polysaccharides supplementation on growth, haematological parameters, whole body composition and survival at low water pH challenge in African catfish (Clarias gariepinus) juveniles, Scientific African 5 (2019) e00128. S. De Baere, J. Goossens, A. Osselaere, M. Devreese, V. Vandenbroucke, P. De Backer, S. Croubels, Quantitative determination of T-2 toxin, HT-2 toxin, deoxynivalenol and deepoxy-deoxynivalenol in animal body fluids using LC-MS/MS detection, Journal of chromatography. B, Analytical technologies in the biomedical and life sciences 879 (24) (2011) 2403–2415. D.P. Anderson, A.K. Siwicki, Basic Hematology and Serology for Fish Health Programs, Fish Health Section, Asian Fisheries Society, 1995, pp. 185–202. K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCT method, Methods 25 (4) (2001) 402–408. M. Qiu, Y.L. Wang, X.B. Wang, L.J. Sun, R.Y. Ye, D.F. Xu, Z. Dai, Y. Liu, S.Y. Bi, Y.P. Yao, R. Gooneratne, Effects of T-2 toxin on growth, immune function and hepatopancreas microstructure of shrimp (Litopenaeus vannamei), Aquaculture 462 (2016) 35–39. X.Y. Zhang, Y. Wang, T. Velkov, S.S. Tang, C.S. Dai, T-2 toxin-induced toxicity in neuroblastoma-2a cells involves the generation of reactive oxygen, mitochondrial dysfunction and inhibition of Nrf2/HO-1 pathway, Food Chem. Toxicol. 114 (2018) 88–97. R. Kohen, B. Nyska, Oxidation of biological systems: oxidative stress phenomena, antioxidants, redox reactions, and methods for their quantification, Toxicol. Pathol. 30 (6) (2002) 620–650. S.W. Xie, W.W. Zhou, L.X. Tian, J. Niu, Y.J. Liu, Effect of N-acetyl cysteine and glycine supplementation on growth performance, glutathione synthesis, anti-oxidative and immune ability of Nile tilapia, Oreochromis niloticus, Fish Shellfish Immunol. 55 (2016) 233–241. M. Yu, Z. Peng, Y.X. Liao, L.L. Wang, D. Li, C.Y. Qin, J.W. Hu, Z.T. Wang, M.Y. Cai, Q. Cai, F. Zhou, S.J. Shi, W. Yang, Deoxynivalenol-induced oxidative stress and Nrf2 translocation in maternal liver on gestation day 12.5 d and 18.5 d, Toxicon 161 (2019) 17–22. G.P. Sykiotis, D. Bohmann, Keap1/Nrf2 signaling regulates oxidative stress tolerance and lifespan in Drosophila, Dev. Cell 14 (1) (2008) 76–85. M.L. Pall, S. Levine, Nrf2, a master regulator of detoxification and also antioxidant, anti-inflammatory and other cytoprotective mechanisms, is raised by health promoting factors, Acta Physiol. Sin. 67 (1) (2015) 1–18. H.D. Li, X.L. Tian, S.L. Dong, Growth performance, non-specific immunity, intestinal histology and disease resistance of Litopenaeus vannamei fed on a diet supplemented with live cells of Clostridium butyricum, Aquaculture 498 (2019) 470–481.
Fish and Shellfish Immunology 97 (2020) 593–601
C. Wang, et al.
microcystin-induced apoptosis in CIK cells, Aquat. Toxicol. 165 (2015) 41–50. [57] X.M. Yin, Signal transduction mediated by Bid, a pro-death Bcl-2 family proteins, connects the death receptor and mitochondria apoptosis pathways, Cell Res. 10 (2000) 161–167. [58] T. Wang, X. Wen, Y.D. Hu, X.Y. Zhang, D. Wang, S.W. Yin, Copper nanoparticles induced oxidation stress, cell apoptosis and immune response in the liver of juvenile Takifugu fasciatus, Fish Shellfish Immunol. 84 (2019) 648–655. [59] J.H. Jiang, Y. Shi, R.X. Yu, L.P. Chen, X.P. Zhao, Biological response of zebrafish after short-term exposure to azoxystrobin, Chemosphere 202 (2018) 56–64. [60] Y. Lin, J.J. Huang, H.U. Dahms, J.J. Zhen, X.P. Ying, Cell damage and apoptosis in the hepatopancreas of Eriocheir sinensis induced by cadmium, Aquat. Toxicol. 190 (2017) 190–198. [61] Y.L. Wang, B.J. Wang, M. Liu, K.Y. Jiang, M.Q. Wang, L. Wang, Comparative transcriptome analysis reveals the different roles between hepatopancreas and intestine of Litopenaeus vannamei in immune response to aflatoxin B1 (AFB1) challenge, Comp. Biochem. Physiol. C Toxicol. Pharmacol. 222 (2019) 1–10. [62] Y. Zhang, Z.Y. Li, S. Kholodkevich, A. Sharov, Y.J. Feng, N.Q. Ren, K. Sun, Cadmium-induced oxidative stress, histopathology, and transcriptome changes in the hepatopancreas of freshwater crayfish (Procambarus clarkii), Sci. Total Environ. 666 (2019) 944–955. [63] X.Y. Ren, L.Q. Pan, L. Wang, The detoxification process, bioaccumulation and damage effect in juvenile white shrimp Litopenaeus vannamei exposed to chrysene, Ecotoxicol. Environ. Saf. 114 (2015) 44–51. [64] Y.Y. Yuan, X.J. Zhou, J.N. Yang, M. Li, X.H. Qiu, T-2 toxin is hydroxylated by chicken CYP3A37, Food Chem. Toxicol. 62 (2013) 622–627. [65] B.Y. Lee, B.S. Choi, M.S. Kim, J.C. Park, C.B. Jeong, J. Han, J.S. Lee, The genome of the freshwater water flea Daphnia magna: a potential use for freshwater molecular ecotoxicology, Aquat. Toxicol. 210 (2019) 69–84. [66] Y. Liu, L. Wang, B.B. Pan, C. Wang, S. Bao, X.P. Nie, Toxic effects of diclofenac on life history parameters and the expression of detoxification-related genes in Daphnia magna, Aquat. Toxicol. 183 (2017) 104–113. [67] Y.J. Deng, Y.L. Wang, L.J. Sun, P.L. Lu, R.D. Wang, L. Ye, D.F. Xu, R.Y. Ye, Y. Liu, S.Y. Bi, R. Gooneratne, Biotransformation enzyme activities and phase I metabolites analysis in Litopenaeus vannamei following intramuscular administration of T-2 toxin, Drug Chem. Toxicol. 41 (1) (2017) 113–122. [68] M.I. El-Barbary, Impact of garlic and curcumin on the hepatic histology and cytochrome P450 gene expression of aflatoxicosis Oreochromis niloticus using RT-PCR, Turk. J. Fish. Aquat. Sci. 18 (3) (2018) 405–415. [69] L. Rey-Salgueiro, J. Costa, M. Ferreira, M.A. Reis-Henriques, Evaluation of 3-hydroxy-benzo[a]pyrene levels in Nile tilapia (Oreochromis niloticus) after waterborne exposure to Benzo[a]pyrene, Toxicol, Environ. Chem. 93 (10) (2011) 2040–2054. [70] L. Wang, Y. Peng, X.P. Nie, B.B. Pan, P.J. Ku, S. Bao, Gene response of CYP360A, CYP314, and GST and whole-organism changes in Daphnia magna exposed to ibuprofen, Comp. Biochem. Physiol. C Toxicol. Pharmacol. 179 (2016) 49–56.
[45] Q.X. She, Z.B. Han, S.D. Liang, W.B. Xu, X. Li, Y.Y. Zhao, H. Wei, J. Dong, Y.D. Li, Impacts of circadian rhythm and melatonin on the specific activities of immune and antioxidant enzymes of the Chinese mitten crab (Eriocheir sinensis), Fish Shellfish Immunol. 89 (2019) 345–353. [46] Q. Qin, S.J. Qin, L. Wang, W.W. Lei, Immune responses and ultrastructural changes of hemocytes in freshwater crab Sinopotamon henanense exposed to elevated cadmium, Aquat. Toxicol. 106–107 (2012) 140–146. [47] S.M. Sun, J.G. Qin, N. Yu, X.P. Ge, H.B. Jiang, L.Q. Chen, Effect of dietary copper on the growth performance, non-specific immunity and resistance to Aeromonas hydrophila of juvenile Chinese mitten crab, Eriocheir sinensis, Fish Shellfish Immunol. 34 (5) (2013) 1195–1201. [48] G.L. Di, Z.X. Zhang, C.H. Ke, Phagocytosis and respiratory burst activity of haemocytes from the ivory snail, Babylonia areolata, Fish Shellfish Immunol. 35 (2) (2013) 366–374. [49] J. Xiong, M. Jin, Y. Yuan, J.X. Luo, Y. Lu, Q.C. Zhou, C. Liang, Z.L. Tan, Dietary nucleotide-rich yeast supplementation improves growth, innate immunity and intestinal morphology of Pacific white shrimp (Litopenaeus vannamei), Aquacult. Nutr. 24 (5) (2018) 1425–1435. [50] Y.H. Hong, Y. Huang, G.W. Yan, C. Pan, J.L. Zhang, Antioxidative status, immunological responses, and heat shock protein expression in hepatopancreas of Chinese mitten crab, Eriocheir sinensis under the exposure of glyphosate, Fish Shellfish Immunol. 86 (2019) 840–845. [51] M.D. Zoysa, C. Nikapitiya, C. Oh, I. Whang, J.S. Lee, S.J. Jung, C.Y. Choi, J. Lee, Molecular evidence for the existence of lipopolysaccharide-induced TNF-alpha factor (LITAF) and Rel/NF-kB pathways in disk abalone (Haliotis discus discus), Fish Shellfish Immunol. 28 (5–6) (2010) 754–763. [52] K.Z. Wang, L. Feng, W.D. Jiang, P. Wu, Y. Liu, J. Jiang, S.Y. Kuang, L. Tang, Y.A. Zhang, X.Q. Zhou, Dietary gossypol reduced intestinal immunity and aggravated inflammation in on-growing grass carp (Ctenopharyngodon idella), Fish Shellfish Immunol. 86 (2019) 814–831. [53] S.W. Xie, L. Zheng, M.G. Wan, J. Niu, Y.J. Liu, L.X. Tian, Effect of deoxynivalenol on growth performance, histological morphology, anti-oxidative ability and immune response of juvenile Pacific white shrimp, Litopenaeus vannamei, Fish Shellfish Immunol. 82 (2018) 442–452. [54] P. Jin, J. Hu, J.J. Qian, L.M. Chen, X.F. Xu, F. Ma, Identification and characterization of a putative lipopolysaccharide-induced TNF-alpha factor (LITAF) gene from Amphioxus (Branchiostoma belcheri): an insight into the innate immunity of Amphioxus and the evolution of LITAF, Fish Shellfish Immunol. 32 (6) (2012) 1223–1228. [55] X.Z. Wang, W.D. Jiang, L. Feng, P. Wu, Y. Liu, Y.Y. Zeng, J. Jiang, S.Y. Kuang, L. Tang, W.N. Tang, X.Q. Zhou, Low or excess levels of dietary cholesterol impaired immunity and aggravated inflammation response in young grass carp (Ctenopharyngodon idella), Fish Shellfish Immunol. 78 (2018) 202–221. [56] X. Huang, L. Chen, W.J. Liu, Q. Qiao, K. Wu, J. Wen, C.H. Huang, R. Tang, X.Z. Zhang, Involvement of oxidative stress and cytoskeletal disruption in
601
Contents lists available at ScienceDirect
Fish and Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
T-2 toxin in the diet suppresses growth and induces immunotoxicity in juvenile Chinese mitten crab (Eriocheir sinensis)
T
Chunling Wanga, Xiaodan Wanga,∗, Shusheng Xiaoa, Xianyong Bua, Zhideng Lina, Changle Qia, Jian G. Qinb, Liqiao Chena,∗∗ a b
Laboratory of Aquaculture Nutrition and Environmental Health, School of Life Sciences, East China Normal University, 500 Dongchuan Rd, Shanghai, 200241, China School of Biological Sciences, Flinders University, Adelaide, SA, 5001, Australia
A R T I C LE I N FO
A B S T R A C T
Keywords: T-2 toxin Eriocheir sinensis juvenile Immunotoxic Growth Hepatopancreas
The T-2 toxin is a trichothecene mycotoxin and is highly toxic to aquatic animals, but little is known on its toxic effect in crustaceans. In the present study, the crab juveniles were fed with diets containing four levels of T-2 toxin: 0 (control), 0.6 (T1), 2.5 (T2) and 5.0 (T3) mg/kg diet for 56 days to evaluate its impact on the juvenile of Chinese mitten crab (Eriocheir sinensis). The crabs fed the T-2 toxin diets had significantly lower weight gain and specific growth rate than those fed the control diet. Moreover, crab survival in T3 group was obviously lower than that in the control. Oxidative stress occurred in all the treatment groups as indicated by higher activities of total superoxide dismutase, glutathione peroxidase, and total antioxidant capacity than those in the control. The total hemocyte count, respiratory burst, phenoloxidase in the hemolymph, and phenoloxidase, acid phosphatase and alkaline phosphatase in the hepatopancreas of crabs fed T-2 toxin were significantly lower than those in the control. The transcriptional expressions of lipopolysaccharide-induced TNF-alpha factor, relish, and the apoptosis genes in the hepatopancreas were induced by dietary T-2 toxin. The genes related to detoxication including cytochrome P450 gene superfamily and glutathione S transferase were induced in low concentration, then decreased in high concentration. Dietary T-2 toxin damaged the hepatopancreas structure, especially as seen in the detached basal membrane of hepatopancreatic tubules. This study indicates that dietary T-2 toxin can reduce growth performance, deteriorate health status and cause hepatopancreas dysfunction in crabs.
1. Introduction T-2 toxin is one of the trichothecenes that are a secondary metabolites produced by various fungus species of the genus Fusarium. This toxin is stable in various environmental conditions even by autoclavation and can cause adverse impact such as growth retardation, hepatic damage, immunotoxicity and blood cell reduction [1–4]. The WHO and FAO have listed T-2 toxin a dangerous source of food pollution in nature since 1973 [5]. Because T-2 toxin commonly contaminates grain products including maize, wheat and oats all over the world especially at high temperature and high moisture regions during cultivation and storage [6]. In recent years, the replacement of fish meal by plant proteins has been accepted as a reality, which increases the risk of mycotoxin contamination such as T-2 toxin in aquatic feed [7]. Therefore, considering the danger and economic loss of T-2 toxin in aquaculture, we face an urgent need to understand the toxic effects of T-2 toxin in aquaculture through feed.
∗
Previous studies have revealed that T-2 toxin can cause growth inhibition, low survival, hepatic injury and immunotoxicity in aquatic animals [8–10]. When the diet is contaminated by T-2, even as low as 0.5 mg/kg, shrimp reduce weight gain [8]. T-2 exposure can also cause weight reduction and kidneys injury in channel catfish [10]. In addition, an exposure to dietary T-2 toxin can exert oxidative stress by increasing the production of free radicals in fish and chicken [7,11]. Furthermore, T-2 toxin can cause immune system damage, inflammation response and apoptosis in Pacific white shrimp, rats and zebrafish [12–14]. Exposure to 0.1 μmol/L or more of T-2 toxin can cause cell apoptosis mainly around the tail area [14]. The dose of 5.3 mg/kg dietary T-2 toxin would decrease non-specific immunity with a reduction of blood cells and an increase of inflammatory cytokines in carp [15]. Apart from the impact of economic loss in aquaculture, dietary T-2 can affect the quality of edible meat of aquatic animals by trace residues. The levels of 17.52 ± 2.87 ng/g and 48.61 ± 3.13 ng/g of
Corresponding author. LANEH, School of Life Sciences, East China Normal University, Dongchuan Road, 200241, Shanghai, PR China. Corresponding author. LANEH, School of Life Sciences, East China Normal University, Dongchuan Road, 200241, Shanghai, PR China. E-mail addresses: [email protected] (C. Wang), [email protected] (X. Wang), [email protected] (L. Chen).
∗∗
https://doi.org/10.1016/j.fsi.2019.12.085 Received 13 August 2019; Received in revised form 23 December 2019; Accepted 27 December 2019 Available online 28 December 2019 1050-4648/ © 2019 Elsevier Ltd. All rights reserved.
Fish and Shellfish Immunology 97 (2020) 593–601
C. Wang, et al.
modified-masked toxins (mT-2s) were found in the hepatopancreas of shrimp following exposure to different levels of T-2 toxin for 20 d, posing a potential health risk to consumers [8]. It is therefore necessary to understand the detoxification mechanism to alleviate the toxic effects of T-2 toxin and ensure seafood safety to consumers. The liver is the main detoxifying organ for T-2 toxin [16,17] and the cytochrome p450 enzymes (phase Ι) and glutathione-S-transferase (phase Π) in the liver play an important role in biotransformation and detoxification of xenobiotics such as T-2 toxin [18,19]. The Chinese mitten crab, Eriocheir sinensis, is a native and important freshwater economic species and its nutrition requirement for growth performance [20–22], metabolism [23,24], immunity [25–27] and disease resistance [28–30] have been well documented. However, little is known on the impact of toxic materials from feed of crabs. A recent study shows that environmental toxin such as benzo[a]pyrene (BaP) can disturb immune system more than metabolic system in crabs [26]. In the diet ingredients of crabs such as maize and wheat are easily contaminated by mycotoxins like T-2 toxin [31]. Up to date, the impacts of T-2 toxin on other aquatic animals such as Pacific white shrimp [8], black tiger shrimp [9] and rainbow trout [32] have been reported, but no data have been reported on its toxicity in crabs. Therefore, in the present study, the effects of the T-2 toxin on growth performance, oxidative stress, immune function and biotransformation enzyme activities were investigated in the juvenile of Chinese mitten crab to gain insight into the T-2 toxic effect and its influence on meat quality in crabs.
Table 1 Formulation and proximate composition of experimental diets (g kg−1 dry basis). Ingredients
C
T1
T2
T3
Fish meal Casein Gelatine Corn starch Fish oil Soybean oil Vitamin premixa Mineral premixb Cholesterol Soylecithin CMC Choline chloride Betaine Cellulose BHT T-2 toxin(mg) Total Moisture Crude protein Crude lipid Ash T-2 toxin (mg/kg)
230 213 68 250 20 20 30 30 5 10 20 5 10 88.5 0.5 0 1000 82.4 402.0 60.7 78.8 0
230 213 68 250 20 20 30 30 5 10 20 5 10 88.5 0.5 0.625 1000 86.0 405.2 61.6 75.2 0.5
230 213 68 250 20 20 30 30 5 10 20 5 10 88.5 0.5 2.5 1000 83.7 401.8 63.3 78.8 2.0
230 213 68 250 20 20 30 30 5 10 20 5 10 88.5 0.5 5 1000 83.9 403.3 61.6 80.3 4.6
a Vitamin premix (per 100 g premix): retinol acetate, 0.043 g; thiamin hydrochloride, 0.15 g; riboflavin, 0.0625 g; Ca pantothenate, 0.3 g; niacin, 0.3 g; pyridoxine hydrochloride, 0.225 g; para-aminobenzoic acid, 0.1 g; ascorbic acid, 0.5 g; biotin, 0.005 g; folic acid, 0.025 g; cholecalciferol, 0.0075 g; αtocopherol acetate, 0.5 g; menadione, 0.05 g; inositol, 1 g. All ingredients are filled with α-cellulose to 100 g. b Mineral premix (per 100 g premix): KH2PO4, 21.5 g; NaH2PO4, 10.0 g; Ca (H2PO4)2, 26.5 g; CaCO3, 10.5 g; KCl, 2.8 g; MgSO4·7H2O, 10.0 g; AlCl3·6H2O, 0.024 g; ZnSO4·7H2O, 0.476 g; MnSO4·6H2O, 0.143 g; KI, 0.023 g; CuCl2·2H2O, 0.015 g; CoCl2·6H2O, 0.14 g Calcium lactate, 16.50 g; Fe-citrate, 1 g. All ingredients are diluted with α-cellulose to 100 g.
2. Materials and methods 2.1. Experimental diets Four practical diets were formulated with different concentrations of T-2 toxin: 0 (control), 0.6 (T1), 2.5 (T2), 5.0 (T3) mg/kg diet, which were designed according to the LC50 of juvenile Pacific white shrimp at the same specification as the crabs we use [8]. The ingredients and proximate composition are presented in Table 1. The T-2 toxin crystalline (Pribolab Pte, Ltd. Singapore; purity > 98%) was dissolved in ethanol and added to the diet. Same amount of ethanol was also added to the control diet. The mixtures were subsequently blended and extruded into 2.5-mm-diameter pellets by a double helix plodder (F-26, SCUT industrial factory, Guangdong, China). Through the extruding process, the extrusion temperature and gelatin and sodium carboxymethyl cellulose pellets in the diets improved the starch digestibility and water stability of diets. These pellets were air-dried to < 10% moisture and stored at −20 °C until use. The proximate composition analysis of diets was analyzed according to the Association of Official Analytical Chemists (AOAC) procedures [33]. Moisture content was analyzed by drying the samples at 105 °C until a constant weight. Crude protein was measured by the Kjeldahl method using Kjeltec™ 8200 (Kjeltec, Foss, Sweden). Lipid was determined by the method of soxhlet apparatus with allihn condenser. Ash content were analyzed by burning the dry samples in a muffle furnace (PCD-E3000 Serials, Peaks, Japan) at 550 °C for 5 h. And T-2 toxin content is detected by liquid chromatography-tandem mass spectrometry methods (LC-MS/MS) [34].
daily at 08:00 and 18:00 for 8 weeks. Two hours after feeding, the uneaten feed and feces were siphoned out. Dead crabs were weighed and recorded during the experiment. The water condition was maintained at 26.0 ± 1.0 °C, 8.5 ± 1.0 mg/L dissolved oxygen and 7.5 ± 0.4 pH throughout the experiment. During the trial, the water was exchanged at 30% of the tank volume daily and natural light-dark cycle was used.
2.3. Sample collection At the end of the 8-week feeding trial, all the crabs were fasted for 24 h, and then the crabs of each bucket were counted and weighed. Crabs were subsequently anaesthetized with ice slurry and then hemolymph was taken with a 1-mL syringe from the joints of walking legs. One part of hemolymph was placed at 4 °C for 24 h and centrifuged at 4500 rpm and 4 °C (5415 R, Eppendorf, Germany) for 10 min to get the serum which was stored at −80 °C for enzyme analysis. The other part was diluted with an equal volume of anticoagulant solution (0.1 M glucose, 30 mM citrate, 26 mM citric acid, 0.14 M NaCl, 10 mM EDTA) to count the numbers of total hemocytes (THC) and determinate the respiratory burst. The hepatopancreas of crabs from each group were quickly separated. Six of hepatopancreas were weighed in a group for calculating the hepatosomatic index. Three of them were fixed in 4% paraformaldehyde for histological analysis and the rest were stored at −80 °C for further analysis of gene expressions and enzymatic activities. All research protocols on live crabs in this study were approved by the Committee on the Ethics of Animal Experiments of East China Normal University.
2.2. Experimental crab and feeding management The juvenile crabs were obtained from a local farm in the Chongming County, Shanghai, China. Crabs were acclimated for 7 days before the experiment. A total of 700 crabs (mean weight 2.00 ± 0.05 g) were randomly divided into four groups with five replicates and thirty-five crabs each in plastic buckets (200 L, 82 × 62 × 58 cm). In each bucket, four arched tiles and six groups of plastic pipes (12 cm long and 3 cm diameter, six pipes per group) were used to reduce attacking. All crabs were fed to apparent satiation twice 594
Fish and Shellfish Immunology 97 (2020) 593–601
C. Wang, et al.
Table 2 Primer pair sequences for real-time qPCR in Chinese mitten crab. Target gene
Primer sequence forward(5’ - 3′)
Primer sequence reverse(5’ - 3′)
Length (bp)
Tm (°C)
LITAF Relish CYP2 CYP3 CYP4 GST Bax Bcl-2 caspase-8 caspase-3 CncC β-actin
TAAAGGCAAGGGAGGCTTCG TCAGGATTCGGTGGCAACTC ACCGCCGCTTCACCTTAC CTCCACGACTACAAGATGTTACGC AAGACTTCGTGGAGGTGTTC CTGTCATCACCATAAAGAAGGCCA GTCAGTGAACCTCAGCTGCAT ATAAGGTGGTTCGCTCCGTC CATGGTGATGAGAATGAC CATTCGCCAGCCTTGCCCACA GCATCCTTCTGGTACCTCGTT CAGGAAATGACCACTGCCGC
GAATGGAGCTTGAGGTGGCA ATCTGCACTTGGACCGATGG CTTGCTTGCCACCATCTGC CACCTCGTTCATGGTAAAGAGC GCACAGCGTTATGTTGGTGAAG CGCCCTGCTCATTCATGTCATAT CACAGCCACATCACCCACGAA TTAACACAGTCCGAGGCCAG TTGGATGAAGTAGAGACG TCTGTCGTGGTTCCTTGTAGCCTT CACTGCTTTGGCTCATCCTTG CGGAACCTCTCATTGCCGA
97 105 188 90 107 114 124 121 120 94 91 95
60.0 60.5 60.3 59.7 59.8 59.6 59.0 59.5 60.2 61.0 60.3 60.8
LITAF: lipopolysaccharide induced TNF factor, CYP2: cytochrome P450, family 2, CYP3: cytochrome P450, family 3, CYP4: cytochrome P450, family 4, GST: glutathione -S-transferase, CncC, cap'n'collar transcription factor.
2.4. Growth performance, survival and hepatosomatic index
an increase in absorbance of 0.001/min.
At the end of the feeding trial, weight gain (WG), specific growth rate (SGR), survival rate (SR) and the hepatosomatic index (HSI) were calculated as follows:
2.6. RT-qPCR analysis in hepatopancreas tissues Total RNA of the hepatopancreas was isolated using Trizol (RN0101, Aidlab, China) following the manufacturer's instructions. The quantity and concentration of total RNA were measured by the Nanodrop 2000 (Thermo, USA). Then the cDNA was synthesized by the reverse transcription kit (KR116, Tiangen Biotech, China) and kept at −20 °C for real-time quantitative PCR (RT-qPCR). The RT-qPCR was performed in the CFX96TM Real-Time system (Bio-Rad, Hercules, CA, USA) with a SYBR kit (PC3302, Aidlab, China). The qPCR reactions were carried out in a final volume of 20 μL, containing 10 μL SYBR mixture, 0.4 μL (10 μM) forward and reverse primers, 8.2 μL H2O and 1 μL cDNA template. The reaction programs were set at 95 °C for 2 min, 40 cycles of 95 °C for 5 s and 60 °C for 30 s with the melt curve ananlysis for 95 °C for 5 s and 0.5 °C per 5 s increment from 65 °C to 95 °C. Relative expression levels were calculated by the 2−ΔΔCT method as described [36] with β-actin as the housekeeping gene. Oligo nucleotide primers were designed using the Oligo 7 (Table 2).
Weight gain (%) = (final weight – initial weight) × 100 / initial weight; Specific growth rate (%/d) = (Ln final weight – Ln initial weight) × 100 /days; Survival rate (%) = Final crab number/ Initial crab number × 100; Hepatosomatic index (%) = (wet hepatopancreatic weight / wet body weight) × 100
2.5. Biochemical assay 2.5.1. Total hemocyte count (THC) measurement The hemocytes were counted on a phase contrast microscope (Nikon TS100, Japan) with a drop of hemolymph-anticoagulant mixture on the hemocytometer.
2.7. Histopathological analysis on the hepatopancreas The hepatopancreas tissue samples were immediately fixed in 4% paraformaldehyde for 24 h, and then dehydrated in a graded series of ethanol (50%–95%) and embedded in paraffin. The 5-μm thickness sections were obtained using a microtome and stained with hematoxylin/eosin (H&E). Histopathological changes were observed on an Axioskop microscope (BX51, Olympus, Tokyo, Japan).
2.5.2. Respiratory burst activity Respiratory burst of the hemolymph was measured using the nitroblue-tetrazolium (NBT; Sangon Biotech Co., Ltd., China) assay following the method of Anderson and Siwicki [35]. Briefly, 100 μL anticoagulant and hemolymph mixture was mixed with 0.1 mL 0.2% NBT solution and incubated for 30 min at room temperature. The N, N-dimethyl formamide (DMF; Sangon Biotech Co., Ltd., China) was added into the mixture and the optical density (OD) of supernatant was measured using a microplate reader at 540 nm with DMF as the blank.
2.8. Statistical analyses All data were statistically analyzed using SPSS statistics 20 (IBM, Armonk, NY, USA) with one-way analysis of variance (ANOVA) and the differences were analyzed among groups by Duncan's multiple-comparison test. A value of P < 0.05 was set as a significant difference.
2.5.3. Enzymatic analysis Acid phosphatase (ACP), alkaline phosphatase (AKP), malondialdehyde (MDA), total superoxide dismutase (T-SOD), total antioxidant capacity (T-AOC), catalase (CAT) and glutathione peroxidase (GPx) activities were detected according to the manufacturer's instructions of commercial kits (Cat. No. A060–2, A059–2, A003–1, A001–1, A015–2, A007-1-1 and A005, Nanjing Jiancheng Bioengineering Institute, China). The phenoloxidase (PO) was evaluated spectrophotometrically using L-DOPA (A610407, Sangon Biotech Co., Ltd., China) as the substrate in a 96-well plate following the method described by Ashida (1971). The enzyme activity was measured at the absorbance of 490 nm wavelength using a microplate reader in an interval of 2 min for 20 min. The PO activity was defined as the amount of enzyme yielding
3. Result 3.1. Growth performance and survival At the end of the 8-week feeding trial, weight gain and specific growth rate significantly decreased in the T-2 toxin treatment groups (P < 0.05) (Fig. 1A and B) compared with those in the control. The lowest survival was observed in the T3 group with 5 mg/kg dietary T-2 toxin (P < 0.05) (Fig. 1E). No significant differences were observed in feed intake and hepatosomatic index among all groups (P > 0.05) 595
Fish and Shellfish Immunology 97 (2020) 593–601
C. Wang, et al.
Fig. 1. Growth performance and survival rate of crabs fed different concentrations of T-2 toxin for 56 days. A. Weight gain; B. Specific growth rate; C. Feed intake; D. Hepatosomatic index; E. Survival rate. Different letters show significant differences among treatments (P < 0.05).
(P < 0.05) (Fig. 3C and F). Dietary T-2 toxin significantly downregulated the ACP and AKP activities in the hepatopancreas (P < 0.05) (Fig. 3G and H), while in the hemolymph, no significant difference was found in ACP and AKP activities among all the groups (P > 0.05) (Fig. 3D and E).
(Fig. 1C and D). 3.2. Antioxidant status in hepatopancreas As shown in Fig. 2, the hepatopancreas MDA content, activities of TSOD, GPx and T-AOC and CncC (cap ‘n’ collar isoform-C) gene expression were significantly affected by dietary T-2 toxin in a dose-dependent manner after the 8-week feeding trial (P < 0.05). Compared with the control, a significant increase in hepatopancreatic MDA and depression of hepatopancreatic T-SOD, GPx, T-AOC and CncC were observed in the T-2 groups (P < 0.05).
3.4. Expression of inflammation-related genes in hepatopancreas The expression of LITAF and relish were significantly upregulated in T3 group compared with the control (P < 0.05) (Fig. 4A). Furthermore, the ALF1 gene expression in T1 group was significantly higher than that in control (P < 0.05) (Fig. 4C). The mRNA level of ALF2 in groups T1 and T2 were markedly higher than those in the control (P < 0.05) (Fig. 4D).
3.3. Enzyme activities of non-specific immunity in hemolymph and hepatopancreas
3.5. Expression of genes associated with apoptosis
THC and respiratory burst activity in the hemolymph significantly decreased compared to the control (P < 0.05) (Fig. 3A and B). Furthermore, the PO activity in the hemolymph and hepatopancreas significantly decreased in the crabs fed T-2 toxin supplementation
Compared with the control, the expression of the caspase-3 gene was significantly increased in the T1 and T3 groups (P < 0.05) Fig. 2. The content of malondialdehyde (MDA) (A), activities of total superoxide dismutase (TSOD) (B), glutathione peroxidase (GPx, GSH-Px) (C) and total antioxidant capacity (T-AOC) (D) and CncC (E) gene expression in the hepatopancreas of crabs fed different concentrations of T-2 toxin for 56 days. Different letters show significant differences among treatments (P < 0.05).
596
Fish and Shellfish Immunology 97 (2020) 593–601
C. Wang, et al.
Fig. 3. Total hemocyte count (THC) (A), respiratory burst (B), phenoloxidase (PO) (C), acid phosphatase (ACP) (D) and alkaline phosphatase (AKP) (E) in hemolymph and phenoloxidase (PO) (F), acid phosphatase (ACP) (G) and alkaline phosphatase (AKP) (H) in hepatopancreas of crabs exposed to different concentrations of T-2 toxin for 56 days. Different letters show significant differences among treatments (P < 0.05).
3.7. Hepatopancreas morphology Compared to the control, the volume of B cell increased, and the number of the R cell decreased in the T-2 toxin group. With the increase of dietary T-2 toxin, the basal membrane of hepatopancreatic tubules was seriously detached and the lumen space was enlarged in the T3 group (Fig. 7).
4. Discussion In the present study, dietary T-2 toxin depressed the growth of juvenile E. sinensis, which is consistent with previous studies on Litopenaeus vannamei [8,37]. The low survival of crabs fed 4.6 mg/kg T2 toxin indicates that the health status of crabs is affected by T-2 toxin. Similarly, a marked reduction in survival was also reported in Pacific white shrimp [8] and rainbow trout [32]. A previous study suggests that reactive oxygen species (ROS) can intensify the toxicity induced by T-2 toxin [38]. The excessive ROS reacts with biological molecules such as lipids, causing lipid peroxidation, and this process can be measured by the content of MDA [39]. According to the present result, the MDA content in hepatopancreas increased when the crabs were fed with T-2 toxin, suggesting that lipid peroxidation is a response in E. sinensis to dietary T-2 toxin. At the same time, T-2 toxin decreased antioxidant enzyme activities (T-SOD, GPx and T-AOC), suggesting that T-2 toxin could attenuate antioxidant capacity in crabs. The T-SOD and GPx are both critical anti-oxidative enzymes with the function of scavenging ROS, and T-AOC is an important index to evaluate the antioxidative status [40]. Moreover, antioxidases could be regulated by the key nucleus transcription factor, nuclear erythroid 2-related factor (Nrf2) to ameliorate oxidative stress in vertebrates [41]. In invertebrates, the CncC gene is orthologous to the vertebrate Nrf2 gene [42]. In this study, the CncC gene expression in the hepatopancreas decreased in the crab fed T-2, suggesting that T-2 toxin could suppress the Nrf2 signal pathway. Furthermore, the activities of antioxidases were positively correlated with Nrf2 gene expression [43], which confirms that T-2 toxin can suppress the antioxidases by inhibiting the Nrf2 signal pathway and suggest that T-2 toxin can impair the anti-oxidative ability and cause oxidative damage in the hepatopancreas of juvenile crabs. Crustaceans lack adaptive immunity and depend solely on the non-
Fig. 4. Relative Lipopolysaccharide-induced tumor necrosis factor-alpha factor (LITAF) (A), relish (B), Anti-lipopolysaccharide factor 1 (ALF1) (C) and Antilipopolysaccharide factor 2 (ALF2) (D) mRNA expression in the hepatopancreas of crabs exposed to different concentrations of T-2 toxin for 56 days. Different letters show significant differences among treatments (P < 0.05).
(Fig. 5A). The expressions of the caspase-8 gene and Bax were significantly increased in T3 group (P < 0.05) (Fig. 5B and C), while expression of Bcl-2 gene was significantly increased in group T1 (P < 0.05) (Fig. 5D).
3.6. Detoxification The mRNA expressions of CYP2, CYP3 and CYP4 in T1 group were higher than in other groups (Fig. 6A, B and 6C). The mRNA level of GST in T2 group was significantly higher than that in the control and T1 or T3 group (P < 0.05) (Fig. 6D).
597
Fish and Shellfish Immunology 97 (2020) 593–601
C. Wang, et al.
Fig. 5. Relative caspase-3 (A), caspase-8 (B), Bax (C) and Bcl-2 (D) mRNA expression and the ratio of Bax/Bcl-2 in the hepatopancreas of crabs exposed to different concentrations of T-2 toxin for 56 days. Different letters show significant differences among treatments (P < 0.05).
and AKP activities of hepatopancreas and PO activities of hepatopancreas and hemolymph in all T-2 toxin additive groups were significantly decreased compared to the control, indicating that dietary T-2 toxin can disable the response to xenobiotics or pathogen. Therefore, these results reveal that dietary T-2 toxin might be detrimental to the innate immune system of E. sinensis. The immune function is also associated with the inflammatory response related to pro-inflammatory cytokines modulated by the transcription factors LITAF and NF-κB [51,52]. In crustaceans, relish is an important member of the NF-κB family, and can induce pro-inflammatory cytokines expression [53]. Moreover, LITAF, as a transcription factor, has a similar function as NF-κB to regulate the expression of TNF-α, a mediator of inflammation [54]. In the present study, the expression of LITAF and relish genes was induced by T-2 toxin in T3 group, indicating that a high concentration of T-2 toxin may induce inflammation in the hepatopancreas of crabs. In addition, ALF1 and ALF2 are important antimicrobial polypeptides and can modulate inflammatory responses by downregulating the release of pro-inflammatory cytokines [55]. After T-2 toxin exposure, ALF1 and ALF2 gene expressions in the hepatopancreas were induced in T1 group and then decreased in T2 and T3 groups with the dose increase of T-2 toxin in the diet. These results suggest that crabs have an adaptability to T-2 toxin stress initially, but the high concentrations T-2 toxin impede the recovery of homoeostasis. The changes of ALF1 and ALF2 gene expressions further prove the occurrence of inflammation in the hepatopancreas induced by T-2 toxin. The oxidative damage can contribute to cell apoptosis in grass carp [56]. This study demonstrates that T-2 toxin resulted in oxidative stress in the hepatopancreas of crabs, suggesting that T-2 toxin may cause cell apoptosis in the hepatopancreas. Other studies show that apoptosis can be initiated mainly by the death receptor pathway (caspase-8) and mitochondrial apoptosis pathway (caspase-3) in mammalian regulated by up-regulating the transcription of pro-apoptotic genes (such as Bax) and anti-apoptotic genes (such as Bcl-2) [57,58]. Bax promotes apoptosis by homodimerizing or heterodimerizing Bcl-2 and the ratio of Bax/Bcl-2 to determine the progress of cell apoptosis [59]. In the present study, apoptosis was characterized by activation of caspase-3, caspase-8 and Bax gene expressions, and inhibition of Bcl-2 gene expression induced by T-2 toxin even at the lowest T-2 concentration (0.5 mg/kg) in the hepatopancreas. These results suggest that apoptosis in the hepatopancreas after T-2 toxin intake is proceeded via both
Fig. 6. Relative CYP2 (A), CYP3 (B), CYP4 (C) and GST (D) mRNA expression in hepatopancreas of crabs exposed to different concentrations of T-2 toxin for 56 days. Different letters show significant differences among treatments (P < 0.05).
specific immune system including against invading microbes [44]. Hematological parameters such as hemolymph cell counts and respiratory burst activity are important for evaluating immune functions [45]. The hemolymph cell count includes semi-granular cells involved in phagocytosis and large granular cells participated in the storage and release of PO, which is a sensitive indicator to reflect the immune status of invertebrates [46,47]. The respiratory burst activity is connected with the mechanism that pathogens and parasites are eliminated following phagocytosis [48]. In this study, the decrease of total hemocyte counts (THCs) and respiratory burst activity following T-2 toxin exposure may be due to the inhibition of mobilization or apoptosis of hemocytes caused by T-2 toxin. Moreover, ACP, AKP, PO activities can reflect the innate immune capacity with important functions of elimination of extracellular invaders [49,50]. In the present study, the ACP 598
Fish and Shellfish Immunology 97 (2020) 593–601
C. Wang, et al.
Fig. 7. Hepatopancreas histopathology of crabs exposed to T-2 toxin for 56 days (H&E 20 x). A-D represent the control, group T1, group T2 and group T3. B: B cells (secretory cells); R: R cell (storage cells). Two-head arrows indicate separation between the myoepithelial layer and the epithelium. Scale bar = 50 μm.
similar observation was reported in a previous study in which diclofenac could activate CYP450 gene expression [66]. This indicates that CYP450 genes may play an important role in catalyzing detoxification of T-2 toxin. In addition, the phase I metabolites are further metabolized by phase II enzyme glutathione S transferase (GST), and play important roles in the detoxification of toxic endogenous substrates in almost all living organisms to produce water-soluble conjugates and make them easier to excrete [67–69]. The most significantly increased hepatopancreatic GST gene expression in T2 group was observed in our study, which probably represents a detoxification response to T-2 exposure. These results are in accordance with a study conducted by Wang et al. [70], who observed an increase at the low dose and a decrease at the high dose of GST activity after exposing Daphnia magna to ibuprofen. Presumably, the upregulations of GST and CYP450 in T1 and T2 may be due to the defense response of crabs and prompt to protecting themselves at a low T-2 dose. The biotransformation system was impaired at high T-2 doses.
mitochondrial apoptotic pathway and death receptor pathway regulated by the Bax/Bcl-2 ratio. The hepatopancreas in crustacean functions as the liver, pancreas, and intestine in vertebrates and plays a critical role in metabolism, nutrient absorption, and immune function [60]. Therefore, it serves as a critical target organ when crabs are exposed to T-2 toxin [8]. Thereby, histopathological alternations of the hepatopancreas could be used to evaluate T-2 toxin toxicity. In the current study, the T-2 toxin at different doses caused considerable histological damage of the hepatopancreas, including B cell dilatation, degenerated R cells and detached basal membrane of hepatopancreatic tubules. Similar histological variations in the hepatopancreas of L. vannamei were also reported by Wang et al. [61] after exposure to aflatoxin B1. This suggests that T-2 toxin can potentially cause an injury and affect physiological functions of the hepatopancreas at the tissue and organ levels. In general, hepatopancreas is the main detoxifying organ for xenobiotics [62]. When animals are exposed to xenobiotic, the biotransformation process in the hepatopancreas is activated for detoxification mediated by the phase I and phase II biotransformation system [63]. In phase I system, xenobiotic or toxin could be metabolized by facilitating bioactivation of the multi-enzymatic system cytochrome P450 (CYP450) gene superfamily. The CYP450 has been identified as a key enzyme in the metabolism of T-2 toxin, and can transform T-2 toxin into 3′–OH–T-2 toxin highly expressed in the liver [64]. Moreover, The CYP2, CYP3 and CYP4 subfamilies have important roles in xenobiotic metabolism in crustaceans [65]. In the present study, the expression of CYP450 homologous genes was significantly induced in the T1 group, and then gradually decreased with the increase of T-2 toxin concentration, displaying a dose-dependent responding relationship. A
5. Conclusion In the present study, the toxic effects of T-2 toxin on E. sinensis was evaluated for the first time. Our data show that the decrease in growth performance and impairment of immune function induced by T-2 toxin might partially be due to (1) oxidative damage caused by ROS and reduction of antioxidase activity associated with the inhibition of CncC gene expression; (2) inflammation, cell apoptosis and hepatopancreatic injury; and (3) reduction in detoxification capacity including the phase I and phase II biotransformation system. These data provide a better insight into the understanding of molecular toxic mechanisms of T-2 599
Fish and Shellfish Immunology 97 (2020) 593–601
C. Wang, et al.
toxin. Our results alert to the awareness of the ecological risks of T-2 toxin in aquatic feed.
[21]
Declaration of competing interest [22]
The authors declare no conflict of interest. Acknowledgements
[23]
This work was supported by Shanghai Sailing Program (Grant No. 18YF1406500), “Chenguang Program” supported by Shanghai Education Development Foundation and Shanghai Municipal Education Commission (Grant No. 17CG26), the National Natural Science Foundation of China (Grant No. 31572629), Agriculture Research System of Shanghai, China (Grant No. 201804) and China Agriculture Research System-48 (CARS-48).
[24]
[25]
[26]
References
[27]
[1] L.C. Yang, D. Tu, Z.Y. Zhao, J. Cui, Cytotoxicity and apoptosis induced by mixed mycotoxins (T-2 and HT-2 toxin) on primary hepatocytes of broilers in vitro, Toxicon 129 (2017) 1–10. [2] S. Marin, A.J. Ramos, G. Cano-Sancho, V. Sanchis, Mycotoxins: occurrence, toxicology, and exposure assessment, Food Chem. Toxicol. 60 (2013) 218–237. [3] Q.F. Wan, G.Y. Wu, Q.H. He, H.R. Tang, Y.L. Wang, The toxicity of acute exposure to T-2 toxin evaluated by the metabonomics technique, Mol. Biosyst. 11 (3) (2015) 882–891. [4] L. Escriva, G. Font, L. Manyes, In vivo toxicity studies of fusarium mycotoxins in the last decade: a review, Food Chem. Toxicol. 78 (2015) 185–206. [5] Z.R. Huang, Y.L. Wang, M. Qiu, L.J. Sun, J.M. Liao, R.D. Wang, X.D. Sun, S.Y. Bi, R. Gooneratne, Effect of T-2 toxin-injected shrimp muscle extracts on mouse macrophage cells (RAW264.7), Drug Chem. Toxicol. 41 (1) (2018) 16–21. [6] M. Adhikari, B. Negi, N. Kaushik, A. Adhikari, A.A. Al-Khedhairy, N.K. Kaushik, E.H. Choi, T-2 mycotoxin: toxicological effects and decontamination strategies, Oncotarget 8 (20) (2017) 33933–33952. [7] H. Modra, E. Sisperova, J. Blahova, V. Enevova, P. Fictum, A. Franc, J. Mares, Z. Svobodova, Elevated concentrations of T-2 toxin cause oxidative stress in the rainbow trout (Oncorhynchus mykiss), Aquacult. Nutr. 24 (2) (2018) 842–849. [8] Y.J. Deng, Y.L. Wang, X.D. Zhang, L.J. Sun, C.J. Wu, Q. Shi, R.D. Wang, X.D. Sun, S.Y. Bi, R. Gooneratne, Effects of T-2 toxin on Pacific white shrimp Litopenaeus vannamei: growth, and antioxidant defenses and capacity and histopathology in the hepatopancreas, J. Aquat. Anim. Health 29 (1) (2017) 15–25. [9] O. Bundit, H. Kanghae, W. Phromkunthong, K. Supamattaya, Effects of mycotoxin T-2 and zearalenone on histopathological changes in black tiger shrimp (Penaeus monodon Fabricius), Songklanakarin J. Sci. Technol. 28 (2006) 937–949. [10] B.B. Manning, M.H. Li, E.H. Robinson, Response of channel catfish to diets containing T-2 toxin, J. Aquat. Anim. Health 15 (2003) 229–238. [11] M. Nakade, C. Pelyhe, B. Kovesi, K. Balogh, B. Kovacs, J. Szabo-Fodor, E. Zandoki, M. Mezes, M. Erdelyi, Short-term effects of T-2 toxin or deoxynivalenol on glutathione status and expression of its regulatory genes in chicken, Acta Vet. Hung. 66 (1) (2018) 28–39. [12] P.L. Lu, Y.L. Wang, Z. Dai, L.J. Sun, D.F. Xu, Y. Liu, R.Y. Ye, R. Gooneratne, S.Y. Bi, Selection and evaluation of indexes commonly used to determine contamination with T-2 toxin in Pacific white shrimp Litopenaeus vannamei by the grey relational method, J. Aquat. Anim. Health 29 (3) (2017) 129–135. [13] M.R. Kazem Ahmadi, Effects of T-2 toxin on cytokine production by mice peritoneal macrophages and lymph node T-cells., Iran, J. Immunol. 5 (3) (2008) 177–180. [14] G.G. Yuan, Y.M. Wang, X.Y. Yuan, T.F. Zhang, J. Zhao, L.Y. Huang, S.Q. Peng, T-2 toxin induces developmental toxicity and apoptosis in zebrafish embryos, J. Environ. Sci. 26 (4) (2014) 917–925. [15] I. Matejova, M. Faldyna, H. Modra, J. Blahova, M. Palikova, Z. Markova, A. Franc, M. Vicenova, L. Vojtek, J. Bartonkova, P. Sehonova, M. Hostovsky, Z. Svobodova, Effect of T-2 toxin-contaminated diet on common carp (Cyprinus carpio L.), Fish Shellfish Immunol. 60 (2017) 458–465. [16] E. Esteban-Zubero, M.A. Alatorre-Jimenez, L. López-Pingarrón, M.C. ReyesGonzales, P. Almeida-Souza, A. Cantín-Golet, F.J. Ruiz-Ruiz, D.X. Tan, J.J. García, R.J. Reiter, Melatonin's role in preventing toxin-related and sepsis-mediated hepatic damage: a review, Pharmacol. Res. 105 (2016) 108–120. [17] J.C. Medina, J.A. Fierro, J. Lara, V. Brito, M. Forat, The effects of 1.2 ppm T-2 Toxin on performance, lesions, and general health of male broilers and the efficiency of an organoaluminosilicate (mycotoxin binder), J. Dairy Sci. 93 (2010) 282–283. [18] X.H. Ge, J.P. Wang, J. Liu, J. Jiang, H.N. Lin, J. Wu, M. Ouyang, X.Q. Tang, M. Zheng, M. Liao, Y.Q. Deng, The catalytic activity of cytochrome P450 3A22 is critical for the metabolism of T-2 toxin in porcine reservoirs, Catal. Commun. 12 (2) (2010) 71–75. [19] C. Wang, P.J. Ku, X.P. Nie, S. Bao, Z.H. Wang, K.B. Li, Effects of simvastatin on the PXR signaling pathway and the liver histology in Mugilogobius abei, Sci. Total Environ. 651 (Pt 1) (2019) 399–409. [20] F.L. Han, X.D. Wang, J.L. Guo, C.L. Qi, C. Xu, Y. Luo, E.C. Li, J.G. Qin, L.Q. Chen, Effects of glycinin and β-conglycinin on growth performance and intestinal health
[28]
[29]
[30]
[31]
[32] [33]
[34]
[35] [36] [37]
[38]
[39]
[40]
[41]
[42] [43]
[44]
600
in juvenile Chinese mitten crabs (Eriocheir sinensis), Fish Shellfish Immunol. 84 (2019) 269–279. C. Xu, E.C. Li, S. Liu, Z.P. Huang, J.G. Qin, L.Q. Chen, Effects of α-lipoic acid on growth performance, body composition, antioxidant status and lipid catabolism of juvenile Chinese mitten crab Eriocheir sinensis fed different lipid percentage, Aquaculture 484 (2018) 286–292. C. Xu, X.D. Wang, F.L. Han, C.L. Qi, E.C. Li, J.L. Guo, J.G. Qin, L.Q. Chen, α-lipoic acid regulate growth, antioxidant status and lipid metabolism of Chinese mitten crab Eriocheir sinensis: optimum supplement level and metabonomics response, Aquaculture 506 (2019) 94–103. Q.Q. Ma, X.D. Wang, Y.Y. Cui, N.N. Zhang, J.G. Qin, Z.Y. Du, L.Q. Chen, Untargeted GC-MS metabolomics reveals metabolic differences in the Chinese mitten-hand crab (Eriocheir sinensis) fed with dietary palm oil or olive oil, Aquacult. Nutr. 24 (6) (2018) 1623–1637. Q.Q. Ma, Q. Chen, Z.H. Shen, D.L. Li, T. Han, J.G. Qin, L.Q. Chen, Z.Y. Du, The metabolomics responses of Chinese mitten-hand crab ( Eriocheir sinensis ) to different dietary oils, Aquaculture 479 (2017) 188–199. Y.L. Chen, L.Q. Chen, J.G. Qin, Z.L. Ding, M. Li, H.B. Jiang, S.M. Sun, Y.Q. Kong, E.C. Li, Growth and immune response of Chinese mitten crab (Eriocheir sinensis) fed diets containing different lipid sources, Aquacult. Res. 47 (6) (2016) 1984–1995. N. Yu, Q.Q. Ding, E.C. Li, J.G. Qin, L.Q. Chen, X.D. Wang, Growth, energy metabolism and transcriptomic responses in Chinese mitten crab (Eriocheir sinensis) to benzo[α]pyrene (BaP) toxicity, Aquat. Toxicol. 203 (2018) 150–158. J.T. Lu, C.L. Qi, S.M. Limbu, F.L. Han, L. Yang, X.D. Wang, J.G. Qin, L.Q. Chen, Dietary mannan oligosaccharide (MOS) improves growth performance, antioxidant capacity, non-specific immunity and intestinal histology of juvenile Chinese mitten crabs (Eriocheir sinensis), Aquaculture 510 (2019) 337–346. L.G. Wang, L.Q. Chen, J.G. Qin, E.C. Li, N. Yu, Z.Y. Du, Y.Q. Kong, J. Qi, Effect of dietary lipids and vitamin E on growth performance, body composition, anti-oxidative ability and resistance to Aeromonas hydrophila challenge of juvenile Chinese mitten crab Eriocheir sinensis, Aquacult. Res. 46 (10) (2015) 2544–2558. J.J. Wei, F. Zhang, W.J. Tian, Y.Q. Kong, Q. Li, N. Yu, Z.Y. Du, Q.Q. Wu, J.G. Qin, L.Q. Chen, Effects of dietary folic acid on growth, antioxidant capacity, non-specific immune response and disease resistance of juvenile Chinese mitten crab Eriocheir sinensis (Milne-Edwards, 1853), Aquacult. Nutr. 22 (3) (2016) 567–574. Y.L. Chen, W.S. Liu, X.D. Wang, E.C. Li, F. Qiao, J.G. Qin, L.Q. Chen, Effect of dietary lipid source and vitamin E on growth, non-specific immune response and resistance to Aeromonas hydrophila challenge of Chinese mitten crab Eriocheir sinensis, Aquacult. Res. 49 (5) (2018) 2023–2032. Y.L. Yi, F. Zhao, N. Wang, H. Liu, L.J. Yu, A.H. Wang, Y.P. Jin, Endoplasmic reticulum stress is involved in the T-2 toxin-induced apoptosis in goat endometrium epithelial cells, J. Appl. Toxicol. 38 (12) (2018) 1492–1501. H.A. Poston, J.L. Copfin, G.F. Combs Jr., Biological effects of dietary T-2 toxin on Rainbow Trout, Salmo gairdneri, Aquat. Toxicol. 2 (1982) 79–88. N.N. Gabriel, M.R. Wilhelm, H.-M. Habte-Tsion, P. Chimwamurombe, E. Omoregie, Dietary garlic (Allium sativum) crude polysaccharides supplementation on growth, haematological parameters, whole body composition and survival at low water pH challenge in African catfish (Clarias gariepinus) juveniles, Scientific African 5 (2019) e00128. S. De Baere, J. Goossens, A. Osselaere, M. Devreese, V. Vandenbroucke, P. De Backer, S. Croubels, Quantitative determination of T-2 toxin, HT-2 toxin, deoxynivalenol and deepoxy-deoxynivalenol in animal body fluids using LC-MS/MS detection, Journal of chromatography. B, Analytical technologies in the biomedical and life sciences 879 (24) (2011) 2403–2415. D.P. Anderson, A.K. Siwicki, Basic Hematology and Serology for Fish Health Programs, Fish Health Section, Asian Fisheries Society, 1995, pp. 185–202. K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCT method, Methods 25 (4) (2001) 402–408. M. Qiu, Y.L. Wang, X.B. Wang, L.J. Sun, R.Y. Ye, D.F. Xu, Z. Dai, Y. Liu, S.Y. Bi, Y.P. Yao, R. Gooneratne, Effects of T-2 toxin on growth, immune function and hepatopancreas microstructure of shrimp (Litopenaeus vannamei), Aquaculture 462 (2016) 35–39. X.Y. Zhang, Y. Wang, T. Velkov, S.S. Tang, C.S. Dai, T-2 toxin-induced toxicity in neuroblastoma-2a cells involves the generation of reactive oxygen, mitochondrial dysfunction and inhibition of Nrf2/HO-1 pathway, Food Chem. Toxicol. 114 (2018) 88–97. R. Kohen, B. Nyska, Oxidation of biological systems: oxidative stress phenomena, antioxidants, redox reactions, and methods for their quantification, Toxicol. Pathol. 30 (6) (2002) 620–650. S.W. Xie, W.W. Zhou, L.X. Tian, J. Niu, Y.J. Liu, Effect of N-acetyl cysteine and glycine supplementation on growth performance, glutathione synthesis, anti-oxidative and immune ability of Nile tilapia, Oreochromis niloticus, Fish Shellfish Immunol. 55 (2016) 233–241. M. Yu, Z. Peng, Y.X. Liao, L.L. Wang, D. Li, C.Y. Qin, J.W. Hu, Z.T. Wang, M.Y. Cai, Q. Cai, F. Zhou, S.J. Shi, W. Yang, Deoxynivalenol-induced oxidative stress and Nrf2 translocation in maternal liver on gestation day 12.5 d and 18.5 d, Toxicon 161 (2019) 17–22. G.P. Sykiotis, D. Bohmann, Keap1/Nrf2 signaling regulates oxidative stress tolerance and lifespan in Drosophila, Dev. Cell 14 (1) (2008) 76–85. M.L. Pall, S. Levine, Nrf2, a master regulator of detoxification and also antioxidant, anti-inflammatory and other cytoprotective mechanisms, is raised by health promoting factors, Acta Physiol. Sin. 67 (1) (2015) 1–18. H.D. Li, X.L. Tian, S.L. Dong, Growth performance, non-specific immunity, intestinal histology and disease resistance of Litopenaeus vannamei fed on a diet supplemented with live cells of Clostridium butyricum, Aquaculture 498 (2019) 470–481.
Fish and Shellfish Immunology 97 (2020) 593–601
C. Wang, et al.
microcystin-induced apoptosis in CIK cells, Aquat. Toxicol. 165 (2015) 41–50. [57] X.M. Yin, Signal transduction mediated by Bid, a pro-death Bcl-2 family proteins, connects the death receptor and mitochondria apoptosis pathways, Cell Res. 10 (2000) 161–167. [58] T. Wang, X. Wen, Y.D. Hu, X.Y. Zhang, D. Wang, S.W. Yin, Copper nanoparticles induced oxidation stress, cell apoptosis and immune response in the liver of juvenile Takifugu fasciatus, Fish Shellfish Immunol. 84 (2019) 648–655. [59] J.H. Jiang, Y. Shi, R.X. Yu, L.P. Chen, X.P. Zhao, Biological response of zebrafish after short-term exposure to azoxystrobin, Chemosphere 202 (2018) 56–64. [60] Y. Lin, J.J. Huang, H.U. Dahms, J.J. Zhen, X.P. Ying, Cell damage and apoptosis in the hepatopancreas of Eriocheir sinensis induced by cadmium, Aquat. Toxicol. 190 (2017) 190–198. [61] Y.L. Wang, B.J. Wang, M. Liu, K.Y. Jiang, M.Q. Wang, L. Wang, Comparative transcriptome analysis reveals the different roles between hepatopancreas and intestine of Litopenaeus vannamei in immune response to aflatoxin B1 (AFB1) challenge, Comp. Biochem. Physiol. C Toxicol. Pharmacol. 222 (2019) 1–10. [62] Y. Zhang, Z.Y. Li, S. Kholodkevich, A. Sharov, Y.J. Feng, N.Q. Ren, K. Sun, Cadmium-induced oxidative stress, histopathology, and transcriptome changes in the hepatopancreas of freshwater crayfish (Procambarus clarkii), Sci. Total Environ. 666 (2019) 944–955. [63] X.Y. Ren, L.Q. Pan, L. Wang, The detoxification process, bioaccumulation and damage effect in juvenile white shrimp Litopenaeus vannamei exposed to chrysene, Ecotoxicol. Environ. Saf. 114 (2015) 44–51. [64] Y.Y. Yuan, X.J. Zhou, J.N. Yang, M. Li, X.H. Qiu, T-2 toxin is hydroxylated by chicken CYP3A37, Food Chem. Toxicol. 62 (2013) 622–627. [65] B.Y. Lee, B.S. Choi, M.S. Kim, J.C. Park, C.B. Jeong, J. Han, J.S. Lee, The genome of the freshwater water flea Daphnia magna: a potential use for freshwater molecular ecotoxicology, Aquat. Toxicol. 210 (2019) 69–84. [66] Y. Liu, L. Wang, B.B. Pan, C. Wang, S. Bao, X.P. Nie, Toxic effects of diclofenac on life history parameters and the expression of detoxification-related genes in Daphnia magna, Aquat. Toxicol. 183 (2017) 104–113. [67] Y.J. Deng, Y.L. Wang, L.J. Sun, P.L. Lu, R.D. Wang, L. Ye, D.F. Xu, R.Y. Ye, Y. Liu, S.Y. Bi, R. Gooneratne, Biotransformation enzyme activities and phase I metabolites analysis in Litopenaeus vannamei following intramuscular administration of T-2 toxin, Drug Chem. Toxicol. 41 (1) (2017) 113–122. [68] M.I. El-Barbary, Impact of garlic and curcumin on the hepatic histology and cytochrome P450 gene expression of aflatoxicosis Oreochromis niloticus using RT-PCR, Turk. J. Fish. Aquat. Sci. 18 (3) (2018) 405–415. [69] L. Rey-Salgueiro, J. Costa, M. Ferreira, M.A. Reis-Henriques, Evaluation of 3-hydroxy-benzo[a]pyrene levels in Nile tilapia (Oreochromis niloticus) after waterborne exposure to Benzo[a]pyrene, Toxicol, Environ. Chem. 93 (10) (2011) 2040–2054. [70] L. Wang, Y. Peng, X.P. Nie, B.B. Pan, P.J. Ku, S. Bao, Gene response of CYP360A, CYP314, and GST and whole-organism changes in Daphnia magna exposed to ibuprofen, Comp. Biochem. Physiol. C Toxicol. Pharmacol. 179 (2016) 49–56.
[45] Q.X. She, Z.B. Han, S.D. Liang, W.B. Xu, X. Li, Y.Y. Zhao, H. Wei, J. Dong, Y.D. Li, Impacts of circadian rhythm and melatonin on the specific activities of immune and antioxidant enzymes of the Chinese mitten crab (Eriocheir sinensis), Fish Shellfish Immunol. 89 (2019) 345–353. [46] Q. Qin, S.J. Qin, L. Wang, W.W. Lei, Immune responses and ultrastructural changes of hemocytes in freshwater crab Sinopotamon henanense exposed to elevated cadmium, Aquat. Toxicol. 106–107 (2012) 140–146. [47] S.M. Sun, J.G. Qin, N. Yu, X.P. Ge, H.B. Jiang, L.Q. Chen, Effect of dietary copper on the growth performance, non-specific immunity and resistance to Aeromonas hydrophila of juvenile Chinese mitten crab, Eriocheir sinensis, Fish Shellfish Immunol. 34 (5) (2013) 1195–1201. [48] G.L. Di, Z.X. Zhang, C.H. Ke, Phagocytosis and respiratory burst activity of haemocytes from the ivory snail, Babylonia areolata, Fish Shellfish Immunol. 35 (2) (2013) 366–374. [49] J. Xiong, M. Jin, Y. Yuan, J.X. Luo, Y. Lu, Q.C. Zhou, C. Liang, Z.L. Tan, Dietary nucleotide-rich yeast supplementation improves growth, innate immunity and intestinal morphology of Pacific white shrimp (Litopenaeus vannamei), Aquacult. Nutr. 24 (5) (2018) 1425–1435. [50] Y.H. Hong, Y. Huang, G.W. Yan, C. Pan, J.L. Zhang, Antioxidative status, immunological responses, and heat shock protein expression in hepatopancreas of Chinese mitten crab, Eriocheir sinensis under the exposure of glyphosate, Fish Shellfish Immunol. 86 (2019) 840–845. [51] M.D. Zoysa, C. Nikapitiya, C. Oh, I. Whang, J.S. Lee, S.J. Jung, C.Y. Choi, J. Lee, Molecular evidence for the existence of lipopolysaccharide-induced TNF-alpha factor (LITAF) and Rel/NF-kB pathways in disk abalone (Haliotis discus discus), Fish Shellfish Immunol. 28 (5–6) (2010) 754–763. [52] K.Z. Wang, L. Feng, W.D. Jiang, P. Wu, Y. Liu, J. Jiang, S.Y. Kuang, L. Tang, Y.A. Zhang, X.Q. Zhou, Dietary gossypol reduced intestinal immunity and aggravated inflammation in on-growing grass carp (Ctenopharyngodon idella), Fish Shellfish Immunol. 86 (2019) 814–831. [53] S.W. Xie, L. Zheng, M.G. Wan, J. Niu, Y.J. Liu, L.X. Tian, Effect of deoxynivalenol on growth performance, histological morphology, anti-oxidative ability and immune response of juvenile Pacific white shrimp, Litopenaeus vannamei, Fish Shellfish Immunol. 82 (2018) 442–452. [54] P. Jin, J. Hu, J.J. Qian, L.M. Chen, X.F. Xu, F. Ma, Identification and characterization of a putative lipopolysaccharide-induced TNF-alpha factor (LITAF) gene from Amphioxus (Branchiostoma belcheri): an insight into the innate immunity of Amphioxus and the evolution of LITAF, Fish Shellfish Immunol. 32 (6) (2012) 1223–1228. [55] X.Z. Wang, W.D. Jiang, L. Feng, P. Wu, Y. Liu, Y.Y. Zeng, J. Jiang, S.Y. Kuang, L. Tang, W.N. Tang, X.Q. Zhou, Low or excess levels of dietary cholesterol impaired immunity and aggravated inflammation response in young grass carp (Ctenopharyngodon idella), Fish Shellfish Immunol. 78 (2018) 202–221. [56] X. Huang, L. Chen, W.J. Liu, Q. Qiao, K. Wu, J. Wen, C.H. Huang, R. Tang, X.Z. Zhang, Involvement of oxidative stress and cytoskeletal disruption in
601